# PaCkAgE DaTaStReAm GNUcoreutils 1 59740 # end of header 0707011d719d45000081a40000000000000000000000014a5bb3b6000000bf0000012e00000002ffffffffffffffff0000001500000000GNUcoreutils/pkginfoPKG=GNUcoreutils NAME=GNU coreutils 7.4 VERSION=7.4 ARCH=i386 CLASSES=none CATEGORY=utility VENDOR=GNU PSTAMP=13thJul09 EMAIL=hsaltiel@gmail.com ISTATES=S s 1 2 3 RSTATES=S s 1 2 3 BASEDIR=/ 0707011d719cb9000081a40000000000000000000000014a5bb3b6000061940000012e00000002ffffffffffffffff0000001400000000GNUcoreutils/pkgmap: 1 59740 1 f none /opt/aosug/bin/[ 0755 root root 121556 36145 1247523531 1 f none /opt/aosug/bin/base64 0755 root root 124472 28487 1247523531 1 f none /opt/aosug/bin/basename 0755 root root 111088 39747 1247523531 1 f none /opt/aosug/bin/cat 0755 root root 160048 4516 1247523531 1 f none /opt/aosug/bin/chcon 0755 root root 182860 49377 1247523531 1 f none /opt/aosug/bin/chgrp 0755 root root 178880 56714 1247523531 1 f none /opt/aosug/bin/chmod 0755 root root 188292 53119 1247523531 1 f none /opt/aosug/bin/chown 0755 root root 182804 48081 1247523531 1 f none /opt/aosug/bin/chroot 0755 root root 110468 12588 1247523531 1 f none /opt/aosug/bin/cksum 0755 root root 117048 38870 1247523531 1 f none /opt/aosug/bin/comm 0755 root root 121524 32649 1247523531 1 f none /opt/aosug/bin/cp 0755 root root 397848 44919 1247523531 1 f none /opt/aosug/bin/csplit 0755 root root 279752 15308 1247523531 1 f none /opt/aosug/bin/cut 0755 root root 140924 32487 1247523531 1 f none /opt/aosug/bin/date 0755 root root 184176 26216 1247523531 1 f none /opt/aosug/bin/dd 0755 root root 164592 40885 1247523531 1 f none /opt/aosug/bin/df 0755 root root 238016 53656 1247523531 1 f none /opt/aosug/bin/dir 0755 root root 316172 44220 1247523531 1 f none /opt/aosug/bin/dircolors 0755 root root 129460 17686 1247523531 1 f none /opt/aosug/bin/dirname 0755 root root 111152 41235 1247523531 1 f none /opt/aosug/bin/du 0755 root root 296860 14040 1247523531 1 f none /opt/aosug/bin/echo 0755 root root 98736 2530 1247523531 1 f none /opt/aosug/bin/env 0755 root root 110144 32365 1247523531 1 f none /opt/aosug/bin/expand 0755 root root 116816 24083 1247523531 1 f none /opt/aosug/bin/expr 0755 root root 263556 5961 1247523531 1 f none /opt/aosug/bin/factor 0755 root root 124244 19613 1247523531 1 f none /opt/aosug/bin/false 0755 root root 95640 34117 1247523531 1 f none /opt/aosug/bin/fmt 0755 root root 122520 35880 1247523531 1 f none /opt/aosug/bin/fold 0755 root root 114852 4495 1247523531 1 f none /opt/aosug/bin/groups 0755 root root 115620 19163 1247523531 1 f none /opt/aosug/bin/head 0755 root root 141472 24617 1247523531 1 f none /opt/aosug/bin/hostid 0755 root root 109716 7 1247523531 1 f none /opt/aosug/bin/id 0755 root root 119276 64718 1247523531 1 f none /opt/aosug/bin/install 0755 root root 386548 3953 1247523531 1 f none /opt/aosug/bin/join 0755 root root 136852 64498 1247523531 1 f none /opt/aosug/bin/kill 0755 root root 113832 43947 1247523531 1 f none /opt/aosug/bin/link 0755 root root 109944 1413 1247523531 1 f none /opt/aosug/bin/ln 0755 root root 289404 9651 1247523531 1 f none /opt/aosug/bin/logname 0755 root root 109812 34345 1247523531 1 f none /opt/aosug/bin/ls 0755 root root 316156 42981 1247523531 1 f none /opt/aosug/bin/md5sum 0755 root root 131884 24847 1247523531 1 f none /opt/aosug/bin/mkdir 0755 root root 134120 54884 1247523531 1 f none /opt/aosug/bin/mkfifo 0755 root root 114632 61558 1247523531 1 f none /opt/aosug/bin/mknod 0755 root root 122624 1316 1247523531 1 f none /opt/aosug/bin/mktemp 0755 root root 137144 15408 1247523531 1 f none /opt/aosug/bin/mv 0755 root root 398796 10144 1247523531 1 f none /opt/aosug/bin/nice 0755 root root 114992 58441 1247523531 1 f none /opt/aosug/bin/nl 0755 root root 255176 48773 1247523531 1 f none /opt/aosug/bin/nohup 0755 root root 117380 9147 1247523531 1 f none /opt/aosug/bin/od 0755 root root 154964 24029 1247523531 1 f none /opt/aosug/bin/paste 0755 root root 113848 65181 1247523531 1 f none /opt/aosug/bin/pathchk 0755 root root 114804 59955 1247523531 1 f none /opt/aosug/bin/pinky 0755 root root 129924 44630 1247523531 1 f none /opt/aosug/bin/pr 0755 root root 180268 36302 1247523531 1 f none /opt/aosug/bin/printenv 0755 root root 109676 45762 1247523531 1 f none /opt/aosug/bin/printf 0755 root root 121132 31427 1247523531 1 f none /opt/aosug/bin/ptx 0755 root root 306884 6085 1247523531 1 f none /opt/aosug/bin/pwd 0755 root root 122596 7388 1247523531 1 f none /opt/aosug/bin/readlink 0755 root root 147872 29161 1247523531 1 f none /opt/aosug/bin/rm 0755 root root 320028 28970 1247523531 1 f none /opt/aosug/bin/rmdir 0755 root root 114436 19470 1247523531 1 f none /opt/aosug/bin/runcon 0755 root root 112260 8368 1247523531 1 f none /opt/aosug/bin/seq 0755 root root 119292 60959 1247523531 1 f none /opt/aosug/bin/sha1sum 0755 root root 136732 32447 1247523531 1 f none /opt/aosug/bin/sha224sum 0755 root root 145624 56474 1247523531 1 f none /opt/aosug/bin/sha256sum 0755 root root 145792 8849 1247523531 1 f none /opt/aosug/bin/sha384sum 0755 root root 226924 13769 1247523531 1 f none /opt/aosug/bin/sha512sum 0755 root root 226924 17340 1247523531 1 f none /opt/aosug/bin/shred 0755 root root 170028 11264 1247523531 1 f none /opt/aosug/bin/shuf 0755 root root 141260 51835 1247523531 1 f none /opt/aosug/bin/sleep 0755 root root 118416 51579 1247523531 1 f none /opt/aosug/bin/sort 0755 root root 243964 32349 1247523531 1 f none /opt/aosug/bin/split 0755 root root 178312 17810 1247523531 1 f none /opt/aosug/bin/stat 0755 root root 155852 26014 1247523531 1 f none /opt/aosug/bin/stty 0755 root root 143612 20590 1247523531 1 f none /opt/aosug/bin/sum 0755 root root 131948 52459 1247523531 1 f none /opt/aosug/bin/sync 0755 root root 108812 38578 1247523531 1 f none /opt/aosug/bin/tac 0755 root root 249816 6582 1247523531 1 f none /opt/aosug/bin/tail 0755 root root 166720 45993 1247523531 1 f none /opt/aosug/bin/tee 0755 root root 112100 26285 1247523531 1 f none /opt/aosug/bin/test 0755 root root 116956 18719 1247523531 1 f none /opt/aosug/bin/timeout 0755 root root 161184 34367 1247523531 1 f none /opt/aosug/bin/touch 0755 root root 158140 45892 1247523531 1 f none /opt/aosug/bin/tr 0755 root root 140780 59164 1247523531 1 f none /opt/aosug/bin/true 0755 root root 95636 33455 1247523531 1 f none /opt/aosug/bin/truncate 0755 root root 163840 60353 1247523531 1 f none /opt/aosug/bin/tsort 0755 root root 119164 21888 1247523531 1 f none /opt/aosug/bin/tty 0755 root root 108692 58474 1247523531 1 f none /opt/aosug/bin/uname 0755 root root 111996 37332 1247523531 1 f none /opt/aosug/bin/unexpand 0755 root root 117780 19862 1247523531 1 f none /opt/aosug/bin/uniq 0755 root root 130216 42068 1247523531 1 f none /opt/aosug/bin/unlink 0755 root root 109804 50661 1247523531 1 f none /opt/aosug/bin/uptime 0755 root root 141004 58349 1247523531 1 f none /opt/aosug/bin/users 0755 root root 115228 5306 1247523531 1 f none /opt/aosug/bin/vdir 0755 root root 316180 50362 1247523531 1 f none /opt/aosug/bin/wc 0755 root root 144860 9354 1247523531 1 f none /opt/aosug/bin/who 0755 root root 135244 60590 1247523531 1 f none /opt/aosug/bin/whoami 0755 root root 110340 54754 1247523531 1 f none /opt/aosug/bin/yes 0755 root root 109076 25356 1247523531 1 f none /opt/aosug/share/info/coreutils.info 0644 root root 726627 25371 1247523532 1 d none /opt/aosug/share/locale/af 0755 root root 1 d none /opt/aosug/share/locale/af/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/af/LC_MESSAGES/coreutils.mo 0644 root root 36315 50661 1247523532 1 d none /opt/aosug/share/locale/af/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/af/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/be/LC_MESSAGES/coreutils.mo 0644 root root 85022 18943 1247523532 1 d none /opt/aosug/share/locale/be/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/be/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/bg 0755 root root 1 d none /opt/aosug/share/locale/bg/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/bg/LC_MESSAGES/coreutils.mo 0644 root root 251583 12698 1247523532 1 d none /opt/aosug/share/locale/bg/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/bg/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/ca 0755 root root 1 d none /opt/aosug/share/locale/ca/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/ca/LC_MESSAGES/coreutils.mo 0644 root root 319000 37016 1247523532 1 d none /opt/aosug/share/locale/ca/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ca/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/cs 0755 root root 1 d none /opt/aosug/share/locale/cs/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/cs/LC_MESSAGES/coreutils.mo 0644 root root 309966 54204 1247523532 1 d none /opt/aosug/share/locale/cs/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/cs/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/da/LC_MESSAGES/coreutils.mo 0644 root root 100498 17175 1247523532 1 d none /opt/aosug/share/locale/da/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/da/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/de/LC_MESSAGES/coreutils.mo 0644 root root 306681 24775 1247523532 1 d none /opt/aosug/share/locale/de/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/de/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/el 0755 root root 1 d none /opt/aosug/share/locale/el/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/el/LC_MESSAGES/coreutils.mo 0644 root root 31226 49033 1247523533 1 d none /opt/aosug/share/locale/el/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/el/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/es/LC_MESSAGES/coreutils.mo 0644 root root 124554 58646 1247523533 1 d none /opt/aosug/share/locale/es/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/es/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/et 0755 root root 1 d none /opt/aosug/share/locale/et/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/et/LC_MESSAGES/coreutils.mo 0644 root root 187794 61340 1247523533 1 d none /opt/aosug/share/locale/et/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/et/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/eu 0755 root root 1 d none /opt/aosug/share/locale/eu/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/eu/LC_MESSAGES/coreutils.mo 0644 root root 15512 36966 1247523533 1 d none /opt/aosug/share/locale/eu/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/eu/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/fi/LC_MESSAGES/coreutils.mo 0644 root root 174630 5773 1247523533 1 d none /opt/aosug/share/locale/fi/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/fi/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/fr/LC_MESSAGES/coreutils.mo 0644 root root 311149 33750 1247523533 1 d none /opt/aosug/share/locale/fr/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/fr/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ga/LC_MESSAGES/coreutils.mo 0644 root root 248970 16156 1247523533 1 d none /opt/aosug/share/locale/ga/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ga/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/gl/LC_MESSAGES/coreutils.mo 0644 root root 46974 35138 1247523533 1 d none /opt/aosug/share/locale/gl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/gl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/hu 0755 root root 1 d none /opt/aosug/share/locale/hu/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/hu/LC_MESSAGES/coreutils.mo 0644 root root 258336 61961 1247523533 1 d none /opt/aosug/share/locale/hu/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/hu/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/id/LC_MESSAGES/coreutils.mo 0644 root root 297380 16989 1247523533 1 d none /opt/aosug/share/locale/id/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/id/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/it 0755 root root 1 d none /opt/aosug/share/locale/it/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/it/LC_MESSAGES/coreutils.mo 0644 root root 66758 36157 1247523533 1 d none /opt/aosug/share/locale/it/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/it/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ja/LC_MESSAGES/coreutils.mo 0644 root root 91394 31108 1247523533 1 d none /opt/aosug/share/locale/ja/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ja/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ko/LC_MESSAGES/coreutils.mo 0644 root root 42556 37027 1247523533 1 d none /opt/aosug/share/locale/ko/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ko/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/lt 0755 root root 1 d none /opt/aosug/share/locale/lt/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/lt/LC_MESSAGES/coreutils.mo 0644 root root 39964 45364 1247523534 1 d none /opt/aosug/share/locale/lt/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/lt/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ms/LC_MESSAGES/coreutils.mo 0644 root root 29145 48257 1247523534 1 d none /opt/aosug/share/locale/ms/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ms/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/nb 0755 root root 1 d none /opt/aosug/share/locale/nb/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/nb/LC_MESSAGES/coreutils.mo 0644 root root 32128 64048 1247523534 1 d none /opt/aosug/share/locale/nb/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/nb/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/nl/LC_MESSAGES/coreutils.mo 0644 root root 301948 506 1247523534 1 d none /opt/aosug/share/locale/nl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/nl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/pl/LC_MESSAGES/coreutils.mo 0644 root root 305957 27634 1247523534 1 d none /opt/aosug/share/locale/pl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/pt 0755 root root 1 d none /opt/aosug/share/locale/pt/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/pt/LC_MESSAGES/coreutils.mo 0644 root root 239479 41654 1247523534 1 d none /opt/aosug/share/locale/pt/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pt/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/pt_BR/LC_MESSAGES/coreutils.mo 0644 root root 252698 26031 1247523534 1 d none /opt/aosug/share/locale/pt_BR/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pt_BR/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ru/LC_MESSAGES/coreutils.mo 0644 root root 284378 43580 1247523534 1 d none /opt/aosug/share/locale/ru/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ru/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/sk/LC_MESSAGES/coreutils.mo 0644 root root 101652 60834 1247523534 1 d none /opt/aosug/share/locale/sk/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sk/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/sl 0755 root root 1 d none /opt/aosug/share/locale/sl/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/sl/LC_MESSAGES/coreutils.mo 0644 root root 256935 12064 1247523534 1 d none /opt/aosug/share/locale/sl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/sv/LC_MESSAGES/coreutils.mo 0644 root root 288687 38821 1247523534 1 d none /opt/aosug/share/locale/sv/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sv/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/tr/LC_MESSAGES/coreutils.mo 0644 root root 151519 55336 1247523534 1 d none /opt/aosug/share/locale/tr/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/tr/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/uk/LC_MESSAGES/coreutils.mo 0644 root root 323650 16407 1247523534 1 d none /opt/aosug/share/locale/uk/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/uk/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/vi/LC_MESSAGES/coreutils.mo 0644 root root 324064 14444 1247523534 1 d none /opt/aosug/share/locale/vi/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/vi/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/zh_CN/LC_MESSAGES/coreutils.mo 0644 root root 51405 18045 1247523535 1 d none /opt/aosug/share/locale/zh_CN/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/zh_CN/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/zh_TW/LC_MESSAGES/coreutils.mo 0644 root root 82818 62295 1247523535 1 d none /opt/aosug/share/locale/zh_TW/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/zh_TW/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/man/man1/base64.1 0644 root root 1883 29076 1247523532 1 f none /opt/aosug/share/man/man1/basename.1 0644 root root 1463 58860 1247523532 1 f none /opt/aosug/share/man/man1/cat.1 0644 root root 2052 43211 1247523532 1 f none /opt/aosug/share/man/man1/chcon.1 0644 root root 2599 26134 1247523532 1 f none /opt/aosug/share/man/man1/chgrp.1 0644 root root 2743 39827 1247523532 1 f none /opt/aosug/share/man/man1/chmod.1 0644 root root 6213 20502 1247523532 1 f none /opt/aosug/share/man/man1/chown.1 0644 root root 4192 36853 1247523532 1 f none /opt/aosug/share/man/man1/chroot.1 0644 root root 1387 51808 1247523532 1 f none /opt/aosug/share/man/man1/cksum.1 0644 root root 1240 39198 1247523532 1 f none /opt/aosug/share/man/man1/comm.1 0644 root root 1906 32732 1247523532 1 f none /opt/aosug/share/man/man1/cp.1 0644 root root 4859 29876 1247523532 1 f none /opt/aosug/share/man/man1/csplit.1 0644 root root 2383 7340 1247523532 1 f none /opt/aosug/share/man/man1/cut.1 0644 root root 2615 28010 1247523532 1 f none /opt/aosug/share/man/man1/date.1 0644 root root 5181 27028 1247523532 1 f none /opt/aosug/share/man/man1/dd.1 0644 root root 3834 61685 1247523532 1 f none /opt/aosug/share/man/man1/df.1 0644 root root 3339 25271 1247523532 1 f none /opt/aosug/share/man/man1/dir.1 0644 root root 7582 1389 1247523532 1 f none /opt/aosug/share/man/man1/dircolors.1 0644 root root 1752 19299 1247523532 1 f none /opt/aosug/share/man/man1/dirname.1 0644 root root 1460 58258 1247523532 1 f none /opt/aosug/share/man/man1/du.1 0644 root root 4394 48603 1247523532 1 f none /opt/aosug/share/man/man1/echo.1 0644 root root 1938 34232 1247523532 1 f none /opt/aosug/share/man/man1/env.1 0644 root root 1536 64618 1247523532 1 f none /opt/aosug/share/man/man1/expand.1 0644 root root 1634 8314 1247523532 1 f none /opt/aosug/share/man/man1/expr.1 0644 root root 2888 40420 1247523532 1 f none /opt/aosug/share/man/man1/factor.1 0644 root root 1306 45514 1247523532 1 f none /opt/aosug/share/man/man1/false.1 0644 root root 1440 58689 1247523532 1 f none /opt/aosug/share/man/man1/fmt.1 0644 root root 2007 41656 1247523532 1 f none /opt/aosug/share/man/man1/fold.1 0644 root root 1535 65354 1247523532 1 f none /opt/aosug/share/man/man1/groups.1 0644 root root 1359 50406 1247523532 1 f none /opt/aosug/share/man/man1/head.1 0644 root root 2069 41861 1247523532 1 f none /opt/aosug/share/man/man1/hostid.1 0644 root root 1248 41270 1247523532 1 f none /opt/aosug/share/man/man1/id.1 0644 root root 1870 28561 1247523532 1 f none /opt/aosug/share/man/man1/install.1 0644 root root 3958 15647 1247523532 1 f none /opt/aosug/share/man/man1/join.1 0644 root root 2887 48771 1247523532 1 f none /opt/aosug/share/man/man1/kill.1 0644 root root 2054 44896 1247523532 1 f none /opt/aosug/share/man/man1/link.1 0644 root root 1281 42338 1247523532 1 f none /opt/aosug/share/man/man1/ln.1 0644 root root 3427 31310 1247523532 1 f none /opt/aosug/share/man/man1/logname.1 0644 root root 1200 36429 1247523532 1 f none /opt/aosug/share/man/man1/ls.1 0644 root root 7575 749 1247523532 1 f none /opt/aosug/share/man/man1/md5sum.1 0644 root root 2052 44070 1247523532 1 f none /opt/aosug/share/man/man1/mkdir.1 0644 root root 1675 11770 1247523532 1 f none /opt/aosug/share/man/man1/mkfifo.1 0644 root root 1504 61830 1247523532 1 f none /opt/aosug/share/man/man1/mknod.1 0644 root root 2103 48415 1247523532 1 f none /opt/aosug/share/man/man1/mktemp.1 0644 root root 2122 50640 1247523532 1 f none /opt/aosug/share/man/man1/mv.1 0644 root root 2907 52059 1247523532 1 f none /opt/aosug/share/man/man1/nice.1 0644 root root 1697 14747 1247523532 1 f none /opt/aosug/share/man/man1/nl.1 0644 root root 2935 55170 1247523532 1 f none /opt/aosug/share/man/man1/nohup.1 0644 root root 1742 19268 1247523532 1 f none /opt/aosug/share/man/man1/od.1 0644 root root 4629 65276 1247523532 1 f none /opt/aosug/share/man/man1/paste.1 0644 root root 1605 6273 1247523532 1 f none /opt/aosug/share/man/man1/pathchk.1 0644 root root 1464 59005 1247523532 1 f none /opt/aosug/share/man/man1/pinky.1 0644 root root 1873 30281 1247523532 1 f none /opt/aosug/share/man/man1/pr.1 0644 root root 4805 15558 1247523532 1 f none /opt/aosug/share/man/man1/printenv.1 0644 root root 1563 3968 1247523532 1 f none /opt/aosug/share/man/man1/printf.1 0644 root root 2312 65320 1247523532 1 f none /opt/aosug/share/man/man1/ptx.1 0644 root root 2897 50297 1247523532 1 f none /opt/aosug/share/man/man1/pwd.1 0644 root root 1559 3263 1247523532 1 f none /opt/aosug/share/man/man1/readlink.1 0644 root root 1995 43411 1247523532 1 f none /opt/aosug/share/man/man1/rm.1 0644 root root 3411 34724 1247523532 1 f none /opt/aosug/share/man/man1/rmdir.1 0644 root root 1568 2051 1247523532 1 f none /opt/aosug/share/man/man1/runcon.1 0644 root root 2195 57351 1247523532 1 f none /opt/aosug/share/man/man1/seq.1 0644 root root 2116 47383 1247523532 1 f none /opt/aosug/share/man/man1/sha1sum.1 0644 root root 2066 45300 1247523532 1 f none /opt/aosug/share/man/man1/sha224sum.1 0644 root root 2082 46014 1247523532 1 f none /opt/aosug/share/man/man1/sha256sum.1 0644 root root 2086 46387 1247523532 1 f none /opt/aosug/share/man/man1/sha384sum.1 0644 root root 2086 46409 1247523532 1 f none /opt/aosug/share/man/man1/sha512sum.1 0644 root root 2086 46332 1247523532 1 f none /opt/aosug/share/man/man1/shred.1 0644 root root 3860 12255 1247523532 1 f none /opt/aosug/share/man/man1/shuf.1 0644 root root 1934 33113 1247523532 1 f none /opt/aosug/share/man/man1/sleep.1 0644 root root 1566 2459 1247523532 1 f none /opt/aosug/share/man/man1/sort.1 0644 root root 4676 10858 1247523532 1 f none /opt/aosug/share/man/man1/split.1 0644 root root 2115 45773 1247523532 1 f none /opt/aosug/share/man/man1/stat.1 0644 root root 3412 27965 1247523532 1 f none /opt/aosug/share/man/man1/stty.1 0644 root root 8588 20725 1247523532 1 f none /opt/aosug/share/man/man1/sum.1 0644 root root 1429 55200 1247523532 1 f none /opt/aosug/share/man/man1/sync.1 0644 root root 1208 36994 1247523532 1 f none /opt/aosug/share/man/man1/tac.1 0644 root root 1622 7626 1247523532 1 f none /opt/aosug/share/man/man1/tail.1 0644 root root 3601 47495 1247523532 1 f none /opt/aosug/share/man/man1/tee.1 0644 root root 1493 61444 1247523532 1 f none /opt/aosug/share/man/man1/test.1 0644 root root 4254 22727 1247523532 1 f none /opt/aosug/share/man/man1/timeout.1 0644 root root 2029 42672 1247523532 1 f none /opt/aosug/share/man/man1/touch.1 0644 root root 2798 43543 1247523532 1 f none /opt/aosug/share/man/man1/tr.1 0644 root root 3233 16450 1247523532 1 f none /opt/aosug/share/man/man1/true.1 0644 root root 1429 57836 1247523532 1 f none /opt/aosug/share/man/man1/truncate.1 0644 root root 2295 62814 1247523532 1 f none /opt/aosug/share/man/man1/tsort.1 0644 root root 1290 44631 1247523532 1 f none /opt/aosug/share/man/man1/tty.1 0644 root root 1335 48632 1247523532 1 f none /opt/aosug/share/man/man1/uname.1 0644 root root 1921 33776 1247523532 1 f none /opt/aosug/share/man/man1/unexpand.1 0644 root root 1772 20633 1247523532 1 f none /opt/aosug/share/man/man1/uniq.1 0644 root root 2569 26854 1247523532 1 f none /opt/aosug/share/man/man1/unlink.1 0644 root root 1277 43111 1247523532 1 f none /opt/aosug/share/man/man1/uptime.1 0644 root root 1572 4120 1247523532 1 f none /opt/aosug/share/man/man1/users.1 0644 root root 1365 51120 1247523532 1 f none /opt/aosug/share/man/man1/vdir.1 0644 root root 7589 2183 1247523532 1 f none /opt/aosug/share/man/man1/wc.1 0644 root root 1855 26228 1247523532 1 f none /opt/aosug/share/man/man1/who.1 0644 root root 2444 10726 1247523532 1 f none /opt/aosug/share/man/man1/whoami.1 0644 root root 1250 40987 1247523532 1 f none /opt/aosug/share/man/man1/yes.1 0644 root root 1242 39604 1247523532 1 i pkginfo 191 14281 1247523766 07070100000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000b00000000TRAILER!!!0707011d719d45000081a40000000000000000000000014a5bb3b6000000bf0000012e00000002ffffffffffffffff0000000800000000pkginfoPKG=GNUcoreutils NAME=GNU coreutils 7.4 VERSION=7.4 ARCH=i386 CLASSES=none CATEGORY=utility VENDOR=GNU PSTAMP=13thJul09 EMAIL=hsaltiel@gmail.com ISTATES=S s 1 2 3 RSTATES=S s 1 2 3 BASEDIR=/ 0707011d719cb9000081a40000000000000000000000014a5bb3b6000061940000012e00000002ffffffffffffffff0000000700000000pkgmap: 1 59740 1 f none /opt/aosug/bin/[ 0755 root root 121556 36145 1247523531 1 f none /opt/aosug/bin/base64 0755 root root 124472 28487 1247523531 1 f none /opt/aosug/bin/basename 0755 root root 111088 39747 1247523531 1 f none /opt/aosug/bin/cat 0755 root root 160048 4516 1247523531 1 f none /opt/aosug/bin/chcon 0755 root root 182860 49377 1247523531 1 f none /opt/aosug/bin/chgrp 0755 root root 178880 56714 1247523531 1 f none /opt/aosug/bin/chmod 0755 root root 188292 53119 1247523531 1 f none /opt/aosug/bin/chown 0755 root root 182804 48081 1247523531 1 f none /opt/aosug/bin/chroot 0755 root root 110468 12588 1247523531 1 f none /opt/aosug/bin/cksum 0755 root root 117048 38870 1247523531 1 f none /opt/aosug/bin/comm 0755 root root 121524 32649 1247523531 1 f none /opt/aosug/bin/cp 0755 root root 397848 44919 1247523531 1 f none /opt/aosug/bin/csplit 0755 root root 279752 15308 1247523531 1 f none /opt/aosug/bin/cut 0755 root root 140924 32487 1247523531 1 f none /opt/aosug/bin/date 0755 root root 184176 26216 1247523531 1 f none /opt/aosug/bin/dd 0755 root root 164592 40885 1247523531 1 f none /opt/aosug/bin/df 0755 root root 238016 53656 1247523531 1 f none /opt/aosug/bin/dir 0755 root root 316172 44220 1247523531 1 f none /opt/aosug/bin/dircolors 0755 root root 129460 17686 1247523531 1 f none /opt/aosug/bin/dirname 0755 root root 111152 41235 1247523531 1 f none /opt/aosug/bin/du 0755 root root 296860 14040 1247523531 1 f none /opt/aosug/bin/echo 0755 root root 98736 2530 1247523531 1 f none /opt/aosug/bin/env 0755 root root 110144 32365 1247523531 1 f none /opt/aosug/bin/expand 0755 root root 116816 24083 1247523531 1 f none /opt/aosug/bin/expr 0755 root root 263556 5961 1247523531 1 f none /opt/aosug/bin/factor 0755 root root 124244 19613 1247523531 1 f none /opt/aosug/bin/false 0755 root root 95640 34117 1247523531 1 f none /opt/aosug/bin/fmt 0755 root root 122520 35880 1247523531 1 f none /opt/aosug/bin/fold 0755 root root 114852 4495 1247523531 1 f none /opt/aosug/bin/groups 0755 root root 115620 19163 1247523531 1 f none /opt/aosug/bin/head 0755 root root 141472 24617 1247523531 1 f none /opt/aosug/bin/hostid 0755 root root 109716 7 1247523531 1 f none /opt/aosug/bin/id 0755 root root 119276 64718 1247523531 1 f none /opt/aosug/bin/install 0755 root root 386548 3953 1247523531 1 f none /opt/aosug/bin/join 0755 root root 136852 64498 1247523531 1 f none /opt/aosug/bin/kill 0755 root root 113832 43947 1247523531 1 f none /opt/aosug/bin/link 0755 root root 109944 1413 1247523531 1 f none /opt/aosug/bin/ln 0755 root root 289404 9651 1247523531 1 f none /opt/aosug/bin/logname 0755 root root 109812 34345 1247523531 1 f none /opt/aosug/bin/ls 0755 root root 316156 42981 1247523531 1 f none /opt/aosug/bin/md5sum 0755 root root 131884 24847 1247523531 1 f none /opt/aosug/bin/mkdir 0755 root root 134120 54884 1247523531 1 f none /opt/aosug/bin/mkfifo 0755 root root 114632 61558 1247523531 1 f none /opt/aosug/bin/mknod 0755 root root 122624 1316 1247523531 1 f none /opt/aosug/bin/mktemp 0755 root root 137144 15408 1247523531 1 f none /opt/aosug/bin/mv 0755 root root 398796 10144 1247523531 1 f none /opt/aosug/bin/nice 0755 root root 114992 58441 1247523531 1 f none /opt/aosug/bin/nl 0755 root root 255176 48773 1247523531 1 f none /opt/aosug/bin/nohup 0755 root root 117380 9147 1247523531 1 f none /opt/aosug/bin/od 0755 root root 154964 24029 1247523531 1 f none /opt/aosug/bin/paste 0755 root root 113848 65181 1247523531 1 f none /opt/aosug/bin/pathchk 0755 root root 114804 59955 1247523531 1 f none /opt/aosug/bin/pinky 0755 root root 129924 44630 1247523531 1 f none /opt/aosug/bin/pr 0755 root root 180268 36302 1247523531 1 f none /opt/aosug/bin/printenv 0755 root root 109676 45762 1247523531 1 f none /opt/aosug/bin/printf 0755 root root 121132 31427 1247523531 1 f none /opt/aosug/bin/ptx 0755 root root 306884 6085 1247523531 1 f none /opt/aosug/bin/pwd 0755 root root 122596 7388 1247523531 1 f none /opt/aosug/bin/readlink 0755 root root 147872 29161 1247523531 1 f none /opt/aosug/bin/rm 0755 root root 320028 28970 1247523531 1 f none /opt/aosug/bin/rmdir 0755 root root 114436 19470 1247523531 1 f none /opt/aosug/bin/runcon 0755 root root 112260 8368 1247523531 1 f none /opt/aosug/bin/seq 0755 root root 119292 60959 1247523531 1 f none /opt/aosug/bin/sha1sum 0755 root root 136732 32447 1247523531 1 f none /opt/aosug/bin/sha224sum 0755 root root 145624 56474 1247523531 1 f none /opt/aosug/bin/sha256sum 0755 root root 145792 8849 1247523531 1 f none /opt/aosug/bin/sha384sum 0755 root root 226924 13769 1247523531 1 f none /opt/aosug/bin/sha512sum 0755 root root 226924 17340 1247523531 1 f none /opt/aosug/bin/shred 0755 root root 170028 11264 1247523531 1 f none /opt/aosug/bin/shuf 0755 root root 141260 51835 1247523531 1 f none /opt/aosug/bin/sleep 0755 root root 118416 51579 1247523531 1 f none /opt/aosug/bin/sort 0755 root root 243964 32349 1247523531 1 f none /opt/aosug/bin/split 0755 root root 178312 17810 1247523531 1 f none /opt/aosug/bin/stat 0755 root root 155852 26014 1247523531 1 f none /opt/aosug/bin/stty 0755 root root 143612 20590 1247523531 1 f none /opt/aosug/bin/sum 0755 root root 131948 52459 1247523531 1 f none /opt/aosug/bin/sync 0755 root root 108812 38578 1247523531 1 f none /opt/aosug/bin/tac 0755 root root 249816 6582 1247523531 1 f none /opt/aosug/bin/tail 0755 root root 166720 45993 1247523531 1 f none /opt/aosug/bin/tee 0755 root root 112100 26285 1247523531 1 f none /opt/aosug/bin/test 0755 root root 116956 18719 1247523531 1 f none /opt/aosug/bin/timeout 0755 root root 161184 34367 1247523531 1 f none /opt/aosug/bin/touch 0755 root root 158140 45892 1247523531 1 f none /opt/aosug/bin/tr 0755 root root 140780 59164 1247523531 1 f none /opt/aosug/bin/true 0755 root root 95636 33455 1247523531 1 f none /opt/aosug/bin/truncate 0755 root root 163840 60353 1247523531 1 f none /opt/aosug/bin/tsort 0755 root root 119164 21888 1247523531 1 f none /opt/aosug/bin/tty 0755 root root 108692 58474 1247523531 1 f none /opt/aosug/bin/uname 0755 root root 111996 37332 1247523531 1 f none /opt/aosug/bin/unexpand 0755 root root 117780 19862 1247523531 1 f none /opt/aosug/bin/uniq 0755 root root 130216 42068 1247523531 1 f none /opt/aosug/bin/unlink 0755 root root 109804 50661 1247523531 1 f none /opt/aosug/bin/uptime 0755 root root 141004 58349 1247523531 1 f none /opt/aosug/bin/users 0755 root root 115228 5306 1247523531 1 f none /opt/aosug/bin/vdir 0755 root root 316180 50362 1247523531 1 f none /opt/aosug/bin/wc 0755 root root 144860 9354 1247523531 1 f none /opt/aosug/bin/who 0755 root root 135244 60590 1247523531 1 f none /opt/aosug/bin/whoami 0755 root root 110340 54754 1247523531 1 f none /opt/aosug/bin/yes 0755 root root 109076 25356 1247523531 1 f none /opt/aosug/share/info/coreutils.info 0644 root root 726627 25371 1247523532 1 d none /opt/aosug/share/locale/af 0755 root root 1 d none /opt/aosug/share/locale/af/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/af/LC_MESSAGES/coreutils.mo 0644 root root 36315 50661 1247523532 1 d none /opt/aosug/share/locale/af/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/af/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/be/LC_MESSAGES/coreutils.mo 0644 root root 85022 18943 1247523532 1 d none /opt/aosug/share/locale/be/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/be/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/bg 0755 root root 1 d none /opt/aosug/share/locale/bg/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/bg/LC_MESSAGES/coreutils.mo 0644 root root 251583 12698 1247523532 1 d none /opt/aosug/share/locale/bg/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/bg/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/ca 0755 root root 1 d none /opt/aosug/share/locale/ca/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/ca/LC_MESSAGES/coreutils.mo 0644 root root 319000 37016 1247523532 1 d none /opt/aosug/share/locale/ca/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ca/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/cs 0755 root root 1 d none /opt/aosug/share/locale/cs/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/cs/LC_MESSAGES/coreutils.mo 0644 root root 309966 54204 1247523532 1 d none /opt/aosug/share/locale/cs/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/cs/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/da/LC_MESSAGES/coreutils.mo 0644 root root 100498 17175 1247523532 1 d none /opt/aosug/share/locale/da/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/da/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/de/LC_MESSAGES/coreutils.mo 0644 root root 306681 24775 1247523532 1 d none /opt/aosug/share/locale/de/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/de/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/el 0755 root root 1 d none /opt/aosug/share/locale/el/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/el/LC_MESSAGES/coreutils.mo 0644 root root 31226 49033 1247523533 1 d none /opt/aosug/share/locale/el/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/el/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/es/LC_MESSAGES/coreutils.mo 0644 root root 124554 58646 1247523533 1 d none /opt/aosug/share/locale/es/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/es/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/et 0755 root root 1 d none /opt/aosug/share/locale/et/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/et/LC_MESSAGES/coreutils.mo 0644 root root 187794 61340 1247523533 1 d none /opt/aosug/share/locale/et/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/et/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/eu 0755 root root 1 d none /opt/aosug/share/locale/eu/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/eu/LC_MESSAGES/coreutils.mo 0644 root root 15512 36966 1247523533 1 d none /opt/aosug/share/locale/eu/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/eu/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/fi/LC_MESSAGES/coreutils.mo 0644 root root 174630 5773 1247523533 1 d none /opt/aosug/share/locale/fi/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/fi/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/fr/LC_MESSAGES/coreutils.mo 0644 root root 311149 33750 1247523533 1 d none /opt/aosug/share/locale/fr/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/fr/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ga/LC_MESSAGES/coreutils.mo 0644 root root 248970 16156 1247523533 1 d none /opt/aosug/share/locale/ga/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ga/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/gl/LC_MESSAGES/coreutils.mo 0644 root root 46974 35138 1247523533 1 d none /opt/aosug/share/locale/gl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/gl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/hu 0755 root root 1 d none /opt/aosug/share/locale/hu/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/hu/LC_MESSAGES/coreutils.mo 0644 root root 258336 61961 1247523533 1 d none /opt/aosug/share/locale/hu/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/hu/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/id/LC_MESSAGES/coreutils.mo 0644 root root 297380 16989 1247523533 1 d none /opt/aosug/share/locale/id/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/id/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/it 0755 root root 1 d none /opt/aosug/share/locale/it/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/it/LC_MESSAGES/coreutils.mo 0644 root root 66758 36157 1247523533 1 d none /opt/aosug/share/locale/it/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/it/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ja/LC_MESSAGES/coreutils.mo 0644 root root 91394 31108 1247523533 1 d none /opt/aosug/share/locale/ja/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ja/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ko/LC_MESSAGES/coreutils.mo 0644 root root 42556 37027 1247523533 1 d none /opt/aosug/share/locale/ko/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ko/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/lt 0755 root root 1 d none /opt/aosug/share/locale/lt/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/lt/LC_MESSAGES/coreutils.mo 0644 root root 39964 45364 1247523534 1 d none /opt/aosug/share/locale/lt/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/lt/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ms/LC_MESSAGES/coreutils.mo 0644 root root 29145 48257 1247523534 1 d none /opt/aosug/share/locale/ms/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ms/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/nb 0755 root root 1 d none /opt/aosug/share/locale/nb/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/nb/LC_MESSAGES/coreutils.mo 0644 root root 32128 64048 1247523534 1 d none /opt/aosug/share/locale/nb/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/nb/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/nl/LC_MESSAGES/coreutils.mo 0644 root root 301948 506 1247523534 1 d none /opt/aosug/share/locale/nl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/nl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/pl/LC_MESSAGES/coreutils.mo 0644 root root 305957 27634 1247523534 1 d none /opt/aosug/share/locale/pl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/pt 0755 root root 1 d none /opt/aosug/share/locale/pt/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/pt/LC_MESSAGES/coreutils.mo 0644 root root 239479 41654 1247523534 1 d none /opt/aosug/share/locale/pt/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pt/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/pt_BR/LC_MESSAGES/coreutils.mo 0644 root root 252698 26031 1247523534 1 d none /opt/aosug/share/locale/pt_BR/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/pt_BR/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/ru/LC_MESSAGES/coreutils.mo 0644 root root 284378 43580 1247523534 1 d none /opt/aosug/share/locale/ru/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/ru/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/sk/LC_MESSAGES/coreutils.mo 0644 root root 101652 60834 1247523534 1 d none /opt/aosug/share/locale/sk/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sk/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 d none /opt/aosug/share/locale/sl 0755 root root 1 d none /opt/aosug/share/locale/sl/LC_MESSAGES 0755 root root 1 f none /opt/aosug/share/locale/sl/LC_MESSAGES/coreutils.mo 0644 root root 256935 12064 1247523534 1 d none /opt/aosug/share/locale/sl/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sl/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/sv/LC_MESSAGES/coreutils.mo 0644 root root 288687 38821 1247523534 1 d none /opt/aosug/share/locale/sv/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/sv/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/tr/LC_MESSAGES/coreutils.mo 0644 root root 151519 55336 1247523534 1 d none /opt/aosug/share/locale/tr/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/tr/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/uk/LC_MESSAGES/coreutils.mo 0644 root root 323650 16407 1247523534 1 d none /opt/aosug/share/locale/uk/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/uk/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/vi/LC_MESSAGES/coreutils.mo 0644 root root 324064 14444 1247523534 1 d none /opt/aosug/share/locale/vi/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/vi/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/zh_CN/LC_MESSAGES/coreutils.mo 0644 root root 51405 18045 1247523535 1 d none /opt/aosug/share/locale/zh_CN/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/zh_CN/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/locale/zh_TW/LC_MESSAGES/coreutils.mo 0644 root root 82818 62295 1247523535 1 d none /opt/aosug/share/locale/zh_TW/LC_TIME 0755 root root 1 s none /opt/aosug/share/locale/zh_TW/LC_TIME/coreutils.mo=../LC_MESSAGES/coreutils.mo 1 f none /opt/aosug/share/man/man1/base64.1 0644 root root 1883 29076 1247523532 1 f none /opt/aosug/share/man/man1/basename.1 0644 root root 1463 58860 1247523532 1 f none /opt/aosug/share/man/man1/cat.1 0644 root root 2052 43211 1247523532 1 f none /opt/aosug/share/man/man1/chcon.1 0644 root root 2599 26134 1247523532 1 f none /opt/aosug/share/man/man1/chgrp.1 0644 root root 2743 39827 1247523532 1 f none /opt/aosug/share/man/man1/chmod.1 0644 root root 6213 20502 1247523532 1 f none /opt/aosug/share/man/man1/chown.1 0644 root root 4192 36853 1247523532 1 f none /opt/aosug/share/man/man1/chroot.1 0644 root root 1387 51808 1247523532 1 f none /opt/aosug/share/man/man1/cksum.1 0644 root root 1240 39198 1247523532 1 f none /opt/aosug/share/man/man1/comm.1 0644 root root 1906 32732 1247523532 1 f none /opt/aosug/share/man/man1/cp.1 0644 root root 4859 29876 1247523532 1 f none /opt/aosug/share/man/man1/csplit.1 0644 root root 2383 7340 1247523532 1 f none /opt/aosug/share/man/man1/cut.1 0644 root root 2615 28010 1247523532 1 f none /opt/aosug/share/man/man1/date.1 0644 root root 5181 27028 1247523532 1 f none /opt/aosug/share/man/man1/dd.1 0644 root root 3834 61685 1247523532 1 f none /opt/aosug/share/man/man1/df.1 0644 root root 3339 25271 1247523532 1 f none /opt/aosug/share/man/man1/dir.1 0644 root root 7582 1389 1247523532 1 f none /opt/aosug/share/man/man1/dircolors.1 0644 root root 1752 19299 1247523532 1 f none /opt/aosug/share/man/man1/dirname.1 0644 root root 1460 58258 1247523532 1 f none /opt/aosug/share/man/man1/du.1 0644 root root 4394 48603 1247523532 1 f none /opt/aosug/share/man/man1/echo.1 0644 root root 1938 34232 1247523532 1 f none /opt/aosug/share/man/man1/env.1 0644 root root 1536 64618 1247523532 1 f none /opt/aosug/share/man/man1/expand.1 0644 root root 1634 8314 1247523532 1 f none /opt/aosug/share/man/man1/expr.1 0644 root root 2888 40420 1247523532 1 f none /opt/aosug/share/man/man1/factor.1 0644 root root 1306 45514 1247523532 1 f none /opt/aosug/share/man/man1/false.1 0644 root root 1440 58689 1247523532 1 f none /opt/aosug/share/man/man1/fmt.1 0644 root root 2007 41656 1247523532 1 f none /opt/aosug/share/man/man1/fold.1 0644 root root 1535 65354 1247523532 1 f none /opt/aosug/share/man/man1/groups.1 0644 root root 1359 50406 1247523532 1 f none /opt/aosug/share/man/man1/head.1 0644 root root 2069 41861 1247523532 1 f none /opt/aosug/share/man/man1/hostid.1 0644 root root 1248 41270 1247523532 1 f none /opt/aosug/share/man/man1/id.1 0644 root root 1870 28561 1247523532 1 f none /opt/aosug/share/man/man1/install.1 0644 root root 3958 15647 1247523532 1 f none /opt/aosug/share/man/man1/join.1 0644 root root 2887 48771 1247523532 1 f none /opt/aosug/share/man/man1/kill.1 0644 root root 2054 44896 1247523532 1 f none /opt/aosug/share/man/man1/link.1 0644 root root 1281 42338 1247523532 1 f none /opt/aosug/share/man/man1/ln.1 0644 root root 3427 31310 1247523532 1 f none /opt/aosug/share/man/man1/logname.1 0644 root root 1200 36429 1247523532 1 f none /opt/aosug/share/man/man1/ls.1 0644 root root 7575 749 1247523532 1 f none /opt/aosug/share/man/man1/md5sum.1 0644 root root 2052 44070 1247523532 1 f none /opt/aosug/share/man/man1/mkdir.1 0644 root root 1675 11770 1247523532 1 f none /opt/aosug/share/man/man1/mkfifo.1 0644 root root 1504 61830 1247523532 1 f none /opt/aosug/share/man/man1/mknod.1 0644 root root 2103 48415 1247523532 1 f none /opt/aosug/share/man/man1/mktemp.1 0644 root root 2122 50640 1247523532 1 f none /opt/aosug/share/man/man1/mv.1 0644 root root 2907 52059 1247523532 1 f none /opt/aosug/share/man/man1/nice.1 0644 root root 1697 14747 1247523532 1 f none /opt/aosug/share/man/man1/nl.1 0644 root root 2935 55170 1247523532 1 f none /opt/aosug/share/man/man1/nohup.1 0644 root root 1742 19268 1247523532 1 f none /opt/aosug/share/man/man1/od.1 0644 root root 4629 65276 1247523532 1 f none /opt/aosug/share/man/man1/paste.1 0644 root root 1605 6273 1247523532 1 f none /opt/aosug/share/man/man1/pathchk.1 0644 root root 1464 59005 1247523532 1 f none /opt/aosug/share/man/man1/pinky.1 0644 root root 1873 30281 1247523532 1 f none /opt/aosug/share/man/man1/pr.1 0644 root root 4805 15558 1247523532 1 f none /opt/aosug/share/man/man1/printenv.1 0644 root root 1563 3968 1247523532 1 f none /opt/aosug/share/man/man1/printf.1 0644 root root 2312 65320 1247523532 1 f none /opt/aosug/share/man/man1/ptx.1 0644 root root 2897 50297 1247523532 1 f none /opt/aosug/share/man/man1/pwd.1 0644 root root 1559 3263 1247523532 1 f none /opt/aosug/share/man/man1/readlink.1 0644 root root 1995 43411 1247523532 1 f none /opt/aosug/share/man/man1/rm.1 0644 root root 3411 34724 1247523532 1 f none /opt/aosug/share/man/man1/rmdir.1 0644 root root 1568 2051 1247523532 1 f none /opt/aosug/share/man/man1/runcon.1 0644 root root 2195 57351 1247523532 1 f none /opt/aosug/share/man/man1/seq.1 0644 root root 2116 47383 1247523532 1 f none /opt/aosug/share/man/man1/sha1sum.1 0644 root root 2066 45300 1247523532 1 f none /opt/aosug/share/man/man1/sha224sum.1 0644 root root 2082 46014 1247523532 1 f none /opt/aosug/share/man/man1/sha256sum.1 0644 root root 2086 46387 1247523532 1 f none /opt/aosug/share/man/man1/sha384sum.1 0644 root root 2086 46409 1247523532 1 f none /opt/aosug/share/man/man1/sha512sum.1 0644 root root 2086 46332 1247523532 1 f none /opt/aosug/share/man/man1/shred.1 0644 root root 3860 12255 1247523532 1 f none /opt/aosug/share/man/man1/shuf.1 0644 root root 1934 33113 1247523532 1 f none /opt/aosug/share/man/man1/sleep.1 0644 root root 1566 2459 1247523532 1 f none /opt/aosug/share/man/man1/sort.1 0644 root root 4676 10858 1247523532 1 f none /opt/aosug/share/man/man1/split.1 0644 root root 2115 45773 1247523532 1 f none /opt/aosug/share/man/man1/stat.1 0644 root root 3412 27965 1247523532 1 f none /opt/aosug/share/man/man1/stty.1 0644 root root 8588 20725 1247523532 1 f none /opt/aosug/share/man/man1/sum.1 0644 root root 1429 55200 1247523532 1 f none /opt/aosug/share/man/man1/sync.1 0644 root root 1208 36994 1247523532 1 f none /opt/aosug/share/man/man1/tac.1 0644 root root 1622 7626 1247523532 1 f none /opt/aosug/share/man/man1/tail.1 0644 root root 3601 47495 1247523532 1 f none /opt/aosug/share/man/man1/tee.1 0644 root root 1493 61444 1247523532 1 f none /opt/aosug/share/man/man1/test.1 0644 root root 4254 22727 1247523532 1 f none /opt/aosug/share/man/man1/timeout.1 0644 root root 2029 42672 1247523532 1 f none /opt/aosug/share/man/man1/touch.1 0644 root root 2798 43543 1247523532 1 f none /opt/aosug/share/man/man1/tr.1 0644 root root 3233 16450 1247523532 1 f none /opt/aosug/share/man/man1/true.1 0644 root root 1429 57836 1247523532 1 f none /opt/aosug/share/man/man1/truncate.1 0644 root root 2295 62814 1247523532 1 f none /opt/aosug/share/man/man1/tsort.1 0644 root root 1290 44631 1247523532 1 f none /opt/aosug/share/man/man1/tty.1 0644 root root 1335 48632 1247523532 1 f none /opt/aosug/share/man/man1/uname.1 0644 root root 1921 33776 1247523532 1 f none /opt/aosug/share/man/man1/unexpand.1 0644 root root 1772 20633 1247523532 1 f none /opt/aosug/share/man/man1/uniq.1 0644 root root 2569 26854 1247523532 1 f none /opt/aosug/share/man/man1/unlink.1 0644 root root 1277 43111 1247523532 1 f none /opt/aosug/share/man/man1/uptime.1 0644 root root 1572 4120 1247523532 1 f none /opt/aosug/share/man/man1/users.1 0644 root root 1365 51120 1247523532 1 f none /opt/aosug/share/man/man1/vdir.1 0644 root root 7589 2183 1247523532 1 f none /opt/aosug/share/man/man1/wc.1 0644 root root 1855 26228 1247523532 1 f none /opt/aosug/share/man/man1/who.1 0644 root root 2444 10726 1247523532 1 f none /opt/aosug/share/man/man1/whoami.1 0644 root root 1250 40987 1247523532 1 f none /opt/aosug/share/man/man1/yes.1 0644 root root 1242 39604 1247523532 1 i pkginfo 191 14281 1247523766 0707011d719d1d000041ed0000000000000000000000034a5bb3b6000000000000012e00000002ffffffffffffffff0000000500000000root0707011d844ea4000041ed0000000000000000000000034a5bb3b6000000000000012e00000002ffffffffffffffff0000000900000000root/opt0707011d719d09000041ed0000000000000000000000044a5bb3b6000000000000012e00000002ffffffffffffffff0000000f00000000root/opt/aosug0707011d719dbd000041ed0000000000000000000000024a5bb3b6000000000000012e00000002ffffffffffffffff0000001300000000root/opt/aosug/bin0707011d719cf5000081ed0000000000000000000000014a5bb2cb0001dad40000012e00000002ffffffffffffffff0000001500000000root/opt/aosug/bin/[ELF@'44 (,+44o ||`/usr/lib/ld.so.1 !"$'()+,-/013678:<=@ADFHIJKLMNOPQSTUWYZ]^_abdefgilnpqstuvxy{}~  #%&*.2459;>?BCEGRVX[\`chjkmorwz| '\( =( IT)U ft)3 s)& m) {) *8 * +- +_ 81 5 5 l6 T89 t7  ,7BJdC Ubm{TG2 G, G" pPQ '2A(KX[1 ku Q R 0$/*%4NG D@$W`] w> X!|Q  U h%%&0'"P%`DDk %!?^ 0 DZ P@' W&^X( f O y4R- @%& ؽq%pE  F DB` %'O p&R &43TT% ; L,F T$\P&d<q0&[|T) &,U% XSR $dZm m%B' 0%&`$[E (S `&H&B B   $ 4@&ؽ60G$ HM i%p%?j r$g'xН~e '~ AF &B  F 0\FE  !dR. <$%`%+\1 P$6XA  BR Q o %@S T$ DZ $ ' S  8E  -&@$#R 0&7 A  N&S U &]D k;q qRD $T= %|U TU'  Z  xAZ  %  DF F\  | Z+ xO  ^ [fsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummylbracket.ctest_syntax_errorbeyondunary_advancefind_intget_mtimebinoptest_unopbinary_operatorunary_operatorone_argumenttwo_argumentsthree_argumentsexprposixtestversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cerror.cerror_taileuidaccess.cexitfail.chard-locale.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsumaxtostr.cvfprintf.cxmalloc.cstrintcmp.cfseterr.cxalloc-die.cxstrndup.cclose-stream.cmbrtowc.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.serrno___Argvquotearg_nquotearg_style_mematexitversion_etc_copyrightsetlocalequotearg_bufferquoting_style_args_environprintf_frexpbindtextdomainquotearg_n_memxcallocset_program_nameerror_print_prognamestrrchrabortstrnlen_get_exit_frame_monitorgetegiderror_one_per_lineerror_message_countstrerror_rversion_etc_va_Jv_RegisterClassesrpl_mbrtowc_startmemcpy_mcountquotearg_alloc_memquotearg_n_stylegeteuidsprintf__environ_lock_initprintf_frexpl_lib_version__iobeuidaccess__ctypeset_quoting_stylebase_nameeaccesswctombquotearg_allocquotearg__dso_handlexmalloc__fsr_init_valuequote_nstrcmpxreallocexit_failurefwritequotearg_freexmemdupumaxtostrrpl_vfprintfclose_streambase_lenlstat64iswprint_exitrpl_strndupquotearg_colonmemsetclose_stdoutclose_stdout_set_file_name_PROCEDURE_LINKAGE_TABLE_set_quoting_flags_end__register_frame_info_bases__flsbuffputc_finirpl_wcrtomb__fsrlast_component__fpendingclose_stdout_set_ignore_EPIPEget_quoting_style__longdouble_usedclone_quoting_optionsquotearg_n_style_mem_edatafflushfputsvasnprintfversion_etcquotearg_style__1cG__CrunMdo_exit_code6F_v_printf_fetchargsstrtolquotearg_colon_memxzallocxstrndupgettextldexpquotearg_char__deregister_frame_info_basesVersionhard_locale__umoddi3_GLOBAL_OFFSET_TABLE___fpstartquotearg_memfclose__udivdi3printf_parsewcslenmbsiniterror_at_lineusagequotearg_char_memx2reallocxstrdup__ctype_mask_etextstrintcmpfseterremit_bug_reporting_addressisattyquoting_style_valsset_char_quoting_DYNAMICxalloc_dierpl_isnanllibgen.so.1SUNW_1.1libc.so.1SUNW_1.23SUNW_1.22SUNW_1.18SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/lib  '= , 5 y? yI yS '= , (= ] qN f 7 v                          ^` L[nXkwm%&'Haq(CNsbDu|O~]4KgfhFIMeBzPiAYWQj 6sĸR̸ؽ),ygFsȸRиԸ@ظVܸdp8lD#eT B* S$/(,=0E48;<N@9DIH2LP\T{XJ\`$dwh~l0pWtqx5%%h%h%h%h%h %ȸh(%иh0%Ըh8p%ظh@`%ܸhHP%hP@%hX0%h` %hh%hp%hx%h%h%h%h%h% h%h%hp%h`%hP% h@%$h0%(h %,h%0h%4h%8h%<h%@h%Dh%Hh %Lh(%Ph0%Th8p%Xh@`%\hHP%`hP@%dhX0%hh` %lhh%php%thx%xhjj|t RhНtt PEu TRU RP"uD PPURQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[;Rt :ҋu鋃t Pƃ]ÐUS[ߏP$tSjPPt,t P]UVSơdQ0hihd SVhUXZhj W$[$vUS`dt$n3uU\B\t;`}U\UWVS Ɖ@t{A@u+tq-tqƒ0A v*Aƒ0 v@t A@ut! V$ee[^_Ê+uAϊ돍IW뇍vUSӍhRP/t EUS]UWVS1tu[^_]Ðt࿢tпtttttl]Sv1Ҁ8-tÉ@G3w$1҉úÍvUWVS\@d`;ddd֦tT[1dT<-<=dT4,T\t4U\e[^_ÐdTpv1B-~~e:]E=`\E9}d4C1 `\E};]Љ}ExE`\E9ÉE}̡d8!tUԋ81:]E=`\E9}=E EE;]/d4F17`\Uvx5 `dE\EЉU؋}܍;;E}VvU؋4At<}t.E܋}܍;;E|&v1L=U)ډU܋EQË\d4t0>)u ~ hf} h! h}\1Ee[^_ÍvUSP]t,P5hPhT"ZYPh Shh|$~YXhhԩ$eXZhh$LYXhh8$3XZhhp$YXhhy$XZhh`$YXhhG$XZhhX.$YXhh$XZhhį$YXhhذ$kXZhh$RYXhh$9XZhh$ $ZYPhw$ hP5h_ZYPhN$ hɧhŧhH/$YXhh|$$ 5hYZPh$tvUWVS E 0]lY^hhjRXZhӧhɧQ$ɧU$B<} =d~E tt h21tK`\C\;` d4X$GE utd uEPjhh-58hŧhhj j P jUWVSj/]S]t@EE)؃~0u>u]Fuvhe[^_UWVS EuEEEM }1ۍV Cu  WuQhJuW hh?r Phu1XZuhR$ w$ uhж+E EEe[^_ uh փ uh@Ƀ uhp뼃 uh믃 uhķ뢃 uh땃 uhV눃 uhrx uhhWuhuRUEPuuu u UhhC$ hɧhŧh$$XZhh< $SD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$Ve[^ÉP</ZtPSe[^Ív@PSD$lÉD$pÉUhta=pt = tO hltM P RPhè5j" <P- h#uÉPhǨ5jUWVSu uh(u?H  huue[^_ÉRhSVt hʨƒPRhŨhHyvhj w W UhltЃEPuU EQ5hhihEPuU EÐUVSu]t95xt\t5x htSVSߨtjPh[^EPuU EGe[^Ðt9tSPtP5hhhFVSߨulUu u_UWVSjuVtw P?tehVtSPt(hVtSPu1SVl$e[^_U u ju UujUS j(EtP]ÉP]ÍvD$tÐËT$tD$ÐD$VSL$T$ ҋ\$tt11ډ[^Ð11ډ[^ËL$t AT$QÐAT$QWVS0Í|$1$D$߱ 0[^_ÉUVS PÉ69te[^ÃuUWVSl1ۉE=EE}UEEEEE$dEEE} PM 9M}tF}t?EE;E w4MMuM9΋}Mu};]sE\CUM ƒ~Uw$}EWEE}}UU;]s EuMECE}tW}uQ}D;]sM\C;]sE0uC;]sE0ME0CEMA9r;]vCM} EU<};]UMsU?C;]sM"C;]su"C;]sE?C}u U}JtLU)EMuNut}<;]sE\UCJ;]7UuC)1}} EEuuUȋE R)MPPEP\tJ}t}t; ufuE UR}\t}9sEMȉEEE[!w $vB9r댋M }EIM /a}W}M jeuuu uUEO e[^_Ã} } 9M.}$}u}'}E}uuNA}}U;]C;]su\C;]E'C}r}EM;M suE|?bTƒ!O$vr}}6Eifb}};]su\MAC;M s,UMD ;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]su*USPMɋU t1 APq1uuE ]ÍvȐUWVS}MWɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU tUEe[^_ÐU덿nUuju uBÐUVS;H5Ls tC;HrF=t P@D@t VL@He[^ÍvUWVSƅUEL#95HwyV@EUE}PP}ãLt@DS=HM)1<EHE UP|PRE؋E 0uUuUi 9EwI@Et W u_Duu܋U 2uuU E죘e[^_É1DWvUhEU jÍvUhuEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<} EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUWVS E]u x@vjj VS=H0Ojj VS%GÉЃ ؉uԍe[^_UWVSuu PP}Dž2ƋtRWSjP99rۉx1e[^_Í9t VO WUS]St]ÅtvUS ] Sut]ÐtsvUSR]M ۋtsB‰U ]X[u@3vUS]S\ SjP\]Uu uStUS] S SuP7]ÍvUW U1QR}UWVSt$L$--0t@uFA0t@t8@‰)1 FtB0 v1 vAtF0 v9[^_]ÉF0tƒt-0 vр0t @AA0tÃt0 v0t @FÃ0 F@tvAÃt8tA0tÃt8u#0 wF@tvAÃt8t@)1 FtB0 v1 AtF0 v9O@Ã0 [^_]@ƒ0 [^_]Ã0 $~1ÍitZ[^_]ÍGЃ 1;4A0nA0taF0qF0tdI0u EM0t0 ҉눀iF:A~i<ڍCЃ MAЃ )ʉAV0uG0tƒ01҃ ‰Ã0 OÍytj1^tGV0uC0tƒ0 ɉ%GЃ  ƒ0 pM01҃ Q0uG0tƒ01Ƀ aA:Fy^tjFЃ w4 AЃ w))Ήvƒ0 wWGE:Utƒ0 wƒ01Ƀ  GGC:uƒ0 v1ɉ'1҉D$H UhPhǨj<PUu u?tUVSuVE^ 4$ut+}u = tu e[^Ée[1^UWVS u ]}tmtb W)u0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt Ju0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 8 9 # <ɣ؅0COuDB$WxhCS%C;u0CuaC0COuIM9@t@t @Lt Lڢ u̢1O;)׍:9Љs<+898;8s99s<۹x<9s8;<< t<9Љ-3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @FLt L+ u|1XDE |nKI;w0CJu + l 1ۃ؃w ICNCFC? E 21 EEEsEEc E %E EF9sE_;UlURU> PU P uEEG E.EE E PˌEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt P} AURU POUWV T$(t$|$ D$$҉t$ʼn$u9vGD$ 1^_]Ív9<$v1v$ǃuA;4$w19l$r̹Őu 11ʼn1NjD$ ^_]ø )D$$L$ ‰$L$D$L$ Ɖ4$d$9wB;D$8I2UWV(D$@T$DL$ ƅҋD$FEH:MXMpMMHMMLHHHHHHML,MM3MLxLHHHHHHHHHHHHHHHHHHKKKKKIKKKKKIIIIIIIIIIIIIIIIKKKKLHIIIIIIIIIIIIIIIIIIIIIIIIIIKKIKIKIIIIIIIIIIIIIIIIIIIIIIIIIIpKKpKKEKEK KEK KEK K K K K K K K K K K K K K K K K K K K K K K K K K K KEKyIIIIIIyIyIyIIIIyIIyIIIIIIIIIIIIIyIyIyIufffuuufffffffffffffffffffffffffufffuuugtgZg@gguuuuggguguiluPu4uthrhrhrhrsssCthrhrhrhrhr(NULL)occVV((((DDDy((((((((9YIS9iSSS%s: missing argument after %sinvalid integer %s!=-nt-ot-ef-eq-ne-lt-le-gt-ge-ef does not accept -lunknown binary operator-ot does not accept -l-nt does not accept -l!%s: unary operator expected((C)-a-o%s: binary operator expected')' expected, found %s')' expectedtest and/or [bug-coreutils@gnu.org Report %s bugs to %s GNU coreutils/opt/aosug/share/locale]missing `]'extra argument %s--help--versionMatthew BradburnKevin Braunsdorf/.libs/lt-%s (%s) %s Written by %s, %s, and %s. Written by %s and %s. Written by %s. %s %s Report bugs to <%s>. write error%s: %sUnknown system error%s:%d: %s:CPOSIX"`memory exhausted%#.0f%+d(NULL)literalshellshell-alwayscc-maybeescapeclocale7.4Try `%s --help' for more information. Usage: test EXPRESSION or: test or: [ EXPRESSION ] or: [ ] or: [ OPTION Exit with the status determined by EXPRESSION. --help display this help and exit --version output version information and exit An omitted EXPRESSION defaults to false. Otherwise, EXPRESSION is true or false and sets exit status. It is one of: ( EXPRESSION ) EXPRESSION is true ! EXPRESSION EXPRESSION is false EXPRESSION1 -a EXPRESSION2 both EXPRESSION1 and EXPRESSION2 are true EXPRESSION1 -o EXPRESSION2 either EXPRESSION1 or EXPRESSION2 is true -n STRING the length of STRING is nonzero STRING equivalent to -n STRING -z STRING the length of STRING is zero STRING1 = STRING2 the strings are equal STRING1 != STRING2 the strings are not equal INTEGER1 -eq INTEGER2 INTEGER1 is equal to INTEGER2 INTEGER1 -ge INTEGER2 INTEGER1 is greater than or equal to INTEGER2 INTEGER1 -gt INTEGER2 INTEGER1 is greater than INTEGER2 INTEGER1 -le INTEGER2 INTEGER1 is less than or equal to INTEGER2 INTEGER1 -lt INTEGER2 INTEGER1 is less than INTEGER2 INTEGER1 -ne INTEGER2 INTEGER1 is not equal to INTEGER2 FILE1 -ef FILE2 FILE1 and FILE2 have the same device and inode numbers FILE1 -nt FILE2 FILE1 is newer (modification date) than FILE2 FILE1 -ot FILE2 FILE1 is older than FILE2 -b FILE FILE exists and is block special -c FILE FILE exists and is character special -d FILE FILE exists and is a directory -e FILE FILE exists -f FILE FILE exists and is a regular file -g FILE FILE exists and is set-group-ID -G FILE FILE exists and is owned by the effective group ID -h FILE FILE exists and is a symbolic link (same as -L) -k FILE FILE exists and has its sticky bit set -L FILE FILE exists and is a symbolic link (same as -h) -O FILE FILE exists and is owned by the effective user ID -p FILE FILE exists and is a named pipe -r FILE FILE exists and read permission is granted -s FILE FILE exists and has a size greater than zero -S FILE FILE exists and is a socket -t FD file descriptor FD is opened on a terminal -u FILE FILE exists and its set-user-ID bit is set -w FILE FILE exists and write permission is granted -x FILE FILE exists and execute (or search) permission is granted Except for -h and -L, all FILE-related tests dereference symbolic links. Beware that parentheses need to be escaped (e.g., by backslashes) for shells. INTEGER may also be -l STRING, which evaluates to the length of STRING. NOTE: [ honors the --help and --version options, but test does not. test treats each of those as it treats any other nonempty STRING. NOTE: your shell may have its own version of %s, which usually supersedes the version described here. Please refer to your shell's documentation for details about the options it supports. %s home page: General help using GNU software: Report %s translation bugs to License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . ?A=@??|6$F$V$f$v$$$$$$$$$%%&%6%F%V%f%v%%%%%%%%%&&&&6&F&V&f&v&&&&&&&&&''&'6' 5  Н     ``P `` `odoo"P"o`o``0'M@zR|0 L  zR|0 L 8t \ d  P" " $ @' НhT|PPPX`48@ !"#$%&'()*+ &9 N Y`lw@PPX`48@\( D( "-)U ?dDt)3 K`V)& ^\P) b) k*8 u* {+- +_ 81 5 5 l6 T89 t7 :lUpbjdC utx@HL(TG2 !G, /G" HpPQ [gr|[1  &4GV` V` fTs\04 Q R 0$/%NG (@$;D] [> <!`Q o U {h%%&0'"P%9DDk %?^  (Z 4@' ;&BX( J O ]4R- n@%v&~ ؽU%pE  F DB` %'O pp&R 4TT%  0,F 8$@P&H<U0&?|T) e&j,U% rXSR $dZm Q%B' 0%&`$[E (S `&,&B )B   $ @&ؽ0G$  2%p%w?j ;$K'AНGe S'~ YAF h&DB  sF 0\FE  !dR. <$`%\1 P$XA  R    + %2 @S E T$ M DZ V $^ 'd S r 8 E  &  @$ R &    &|S & D  ;q  RD $. T= 9 %@ M T |U 8 TU' ^ Z  f xAZ %  )DF F\ | Z+ \O ^ [fsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummylbracket.ctest_syntax_errorargvbeyondargcunary_advanceposfind_intget_mtimebinoptest_unopbinary_operatorunary_operatorone_argumenttwo_argumentsthree_argumentsexprposixtestversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1euidaccess.cexitfail.chard-locale.cquote.cquotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsumaxtostr.cvfprintf.cxmalloc.cstrintcmp.cfseterr.cxalloc-die.cxstrndup.cclose-stream.cmbrtowc.cinternal_state.0vasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cwide_null_string.0printf-parse.clibgcc2.c.LFB3__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START_errno___Argvquotearg_nquotearg_style_mematexitversion_etc_copyrightsetlocalequotearg_bufferquoting_style_args_environprintf_frexpbindtextdomainquotearg_n_memxcallocset_program_nameerror_print_prognamestrrchrabortstrnlen_get_exit_frame_monitorgetegiderror_one_per_lineerror_message_countstrerror_rversion_etc_va_Jv_RegisterClassesrpl_mbrtowc_startmemcpy_mcountquotearg_alloc_memquotearg_n_stylegeteuidsprintf__environ_lock_initprintf_frexpl_lib_version__iobeuidaccess__ctypeset_quoting_stylebase_nameeaccesswctombquotearg_allocquotearg__dso_handlexmalloc__fsr_init_valuequote_nstrcmpxreallocexit_failurefwritequotearg_freexmemdupumaxtostrrpl_vfprintfclose_streambase_lenlstat64iswprint_exitrpl_strndupquotearg_colonmemsetclose_stdout_PROCEDURE_LINKAGE_TABLE_set_quoting_flags_end__register_frame_info_bases__flsbuffputc_finirpl_wcrtomb__fsrlast_component__fpendingget_quoting_style__longdouble_usedclone_quoting_optionsquotearg_n_style_mem_edatafflushfputsvasnprintfversion_etcquotearg_style__1cG__CrunMdo_exit_code6F_v_printf_fetchargsstrtolquotearg_colon_memxzallocxstrndupgettextldexpquotearg_char__deregister_frame_info_basesVersionhard_locale__umoddi3_GLOBAL_OFFSET_TABLE___fpstartquotearg_memfclose__udivdi3printf_parsewcslenmbsiniterror_at_lineusagequotearg_char_memx2reallocxstrdup__ctype_mask_etextstrintcmpfseterremit_bug_reporting_addressisattyquoting_style_valsset_char_quoting_DYNAMICxalloc_dierpl_isnanl@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I : ;I : ;I8 I !I/ .: ; ' @ : ; I : ; I &I.: ; ' @ .: ; ' I@ 4: ; I 4: ; I 111.: ; ' I : ; I.: ;' I@ : ;I : ;I 4: ;I 4: ;I   4: ;I! U"1 # U$.: ;' I@ %41 &.: ;' I '4: ; I( ).? : ;' @ *1+.: ;' ,.? : ;' I@ -.: ; ' .: ; I/4: ; I? < 05I% 4: ; I?   I&I$ > % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > .? : ; ' I@ : ; I  I&I% $ > $ > 4: ; I?  5I%  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > $ >  I: ;I.? : ; ' I@ : ; I 4: ; I % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > : ; I$ > .? : ; ' I@ : ; I 11 1 U 41 1 1 I&I.: ; ' I : ; I: ; I4: ; I4: ; I.: ; ' I  : ; % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < % $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 11 U4141  U .: ;' I : ;I4: ;I 4: ;I  I&I% $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 4: ;I 111  U4141  .: ;' I : ;I4: ;I 4: ;I  I&Iv ?)'2PU *7U *\ 8#d 9#i ;#o <# u =# | ?#  @ #  A #  B #  C #  D # int K  D&ED3ea%;VAKJ(T  `sh gx m{ sh yh (;<#=(#S##y#### #$#(/#,#4 #< #D #L  #T ! #X + ?#` 5O#p /( / ?( / O% / _( / =R)q)UOQVargQS%Vtt))U c`))Uf_Pk]i))UYq})*U||Vp~QWEY**jYE*G*juch%**UPS~okQ*+TsS.++Top-P +71U Sop | ~ }V,, tj-- m!%}&}l'Sr*Pcmp-Q.R!z lt[|rt[|le\Sre\P /+/"QR" PQ#@lt>}rt>|le?Sre?P//"QR" PQ % /ab` 815U~#Xfd(PargP$/A55T<G5k6UHPJ_l6q7U`VZyt7T8UdxPzVj$T8;UFm8q8%s#%sn{88%k#%k88% S% c#% S% c#% \&or &and % o''t('d)Y |;>US*Y ;;+n, >?US  P R>\> s- w.v , /;/ / :/ /! 0/k3 / pos<\=`> dF??278=BP??j#??U6"jS@)jj*jppuP jhk&A?FT+06P[U%U*S U*\8 #d9#i;#o<# u=# |? # @  # A  # B  # C  # D  # intW[HMc  T  c+?VAU x(p )Q )l *W *= ,9S @,@ 0=R.6 fXAxAU x   =xAAUHK;yAAAPint T O.%y0pBAintMP7!ABT j"Pp#Q<$S P  kp,BCBToRlenq,P r, KDBBUJVjLS%M,P-dCB,PU*7U*\8#d9#i;#o<# u=# |?# @ # A # B # C # D # int T  o7*BBT R)oPu % WOBBT uNk |lBdCU  poP:,;  $ol h.pudoEdCT+06P[U%U*S U*\8 #d9#i;#o<# u=# |? # @  # A  # B  # C  # D  # int 6T  dCDDU  W  V  e= CD  R w6j i skn(65vDDDU     e=DoEU   S Ve=8t x7#:   ^H5; N aXEpE+P intT 8OHpEEURNNH :q! EECintP T <%I ,FEN+Pint T \%E,FUh$9Vq&Wp'P EFa2%Sk +<  YF,Fvintp~p,FDFUn%p v{P &pDFYFU%p-   XS\FintMP7GI!('P T =( ,# % =.?7WO( 1P# k4%# q8W# g7  r s,#valt#I^\FFUo]e_%Sp` iPFFToh,qFFTopspPP|%F0GTo{Rc{i{%Suc}Qp~V%Qr%P_%0GTGToQi%Rr%P  TGGTPRo JJGGUJSsPVJPPN,GNU@ ,argJ+, Pk%qNi,len,S3J@,QYcYrY1EKrLmzL!JIPcescPm,YHPI,RHw>D,W)JKj,RMNJVJWT7kF,NOU C C,R!argDJ +D,!oEpGQeH%SrI,P ` OOU!arg^J +^, ^!o_paWeb%pkd%l e,S"bufg#mOnO$,% &n,  SOOU!argQJ +Q, !oR';' OmPUsv;Vi7Sg(95 pPQU!n%V!argJp +, W e%l"n07sv;Sn1,hH YgQQ,`valWk%\,P#nQzQ$pU QQU!n%P!argJR` QRU!n%P!argJR +,o RRU!argJ x R4RU!argJ +, o  4RaRU!n%!sPR!argJoH  dRRU!n%!sPR!argJ +,oH  RRU!sP!argJ Q  RRU!sP!argJ +,  R SU!argJ +, !chPW     S&SU!argJ!ch   (S=SU!argJJ  @SXSU!argJ +, Z Z J) p ret],P>|P"[[ M?0intP ZT ' }[[UsVn% len%Snew}P Z![3 T+06P[U%intMPZGl6 T HZ = ( ,#H= .@ cl? 2 G Q  \  g  r  ~          !  .  G  `  w   X&   ` ay b c dH eZ fl g i jl"m+nNoH8qzsDuRw\xryz{}$6aHl/ ]#a#3 _ ! O#arg_#/@:,9 -# .# k/H# 0# 1# 2O# 3# 4# .5O# 66#$ 7O#(B9p_C ! >O#dir?_# Q@O# bAO# wCZ B6[ \U- h6s\Us OSe=deXaey]`XS`NDXObufsxsxcpViOxdp_x sxOx%OxZ\\QvZ\c\Z\c\Z\c\xP n\z\P!z\\Rn*Ox +O]#]!]#]P1-O-sSwkHw=HwAOwGHwfbpsWUZwbxargHP_(_!_(_"16O6sSP_V_"i_x_!i_x_" CO``!``P1HOHsV aakOw HkMH=NHxAOOxwPHx{QOx. argYHP J bbargyHPb R arg2 x3 x4 OSw< Ox C bufJ ~! K HP  OV / vc~c" 81 O sVy cc`"cc!cc"!\ddbuf ~!  HSxn5 OW de!de"16 O6 sSL >eDe"Wefe!Wefe"9 F wkH Hw=I HwAJ OwwK H{L OW!M ORN +ytmpO swaP swpQ sS! OS S ffnsOS m ffnOS <f@gN] ahyh!ahyh"# 1OsS hh"hh!hh"Y  ! Hx HQOV L xkM Hx=N HxAO OxwP Hx{Q OW!R ORS +ytmpT swaU swpV sS"H arg^ HP >3jPjarg~ HPV`  Rpj|j!pj|jPjj!jjPx arg[ \!jj]  pad ORend sV!kkkq sQ !  OS( #n Ogkk!kk"X 1 O sW l m O1 j H  mm$l %l %l _ml w  Hx ]  HPYYnnk\!nn"vq( argY HP Vowoargy HPoo!ooPoo!ooP@ arg\!oo; padORendsV #nOypp!pp" 1OsW qqRqqQ P q5ro Rq&rQ PK@rdrQ( Pc@ argR #nO,s\sR,s?s!,s?sP 1OsS sCtargyRS arg RST7 argMZRTarglRS p4uPuargGHR PuluargAZR luuarg;HRH \q OR` HPEO$w*wR!w*wP1OsS]arg ] wyHy OH!yy$%%_mwPp xbufw ~! x HP "{{OVn Ox`||"1 O sVK|Q|"d|s|!d|s|"( H V }}_cw x .}!} x m!})}$]  % % p_m ;y!}}R x }}q sQ ~A~j R~2~QhP (A~~ RJ~n~QP Hx ] \q OR HP HP`Q P ܀jR̀Q8PP pbuf ~!  HWq^u!^u"1% O% sV"Ł!Ł"8#wOpadOW4!P8#nOQ˃˃!P!˃PP1OsSh#rppsQendswaswParg ] j7YqsQ LJqsQ? H w ߇_cw x  x $ $  % % p_m y!kxUqsR o΋q sR 1QOV!r<sPO& NO'MO'MO'MO'#MO&)9O'8O'8O(sum:O+6?<6)*Y.*H+x)*CH+x, &WXO'WO'WO&\DO'CO'CO'COs- :H@O }bintMP7GIP PT =(,#% e=.? 0l,}U sS wc> ps0P 0 ret+%P:%ݍxT intP$B:ݍUxA:[APC,|,T intP$BaB%TxA%\APC,SDVW  _cwFV FV CPXY iZ,Q ya%]b%[ _V Ҏ?|%[}%] ,%H?Iint` DD`DgT w%3DA H:T xG` PQR mSw T%P intMP7GITu[aP[UP T @ cIK2G Q \ g r ~            ! . G ` w   X \  `\ ah b c d% e7 fI g io j lc "mj +n No% 8q zsq Du| Rw \x ry z { }$w a >\%Io  ]K#aV#3  ! ,#arg#@o%%Te$vVa$oUi&,Wap'Sp u '!#intMP7GIP T @ cI/2G Q \ g r ~            ! . G ` w   X@  `@ aW bl cs d% e7 fI g i^ jz lG "mN +n No% 8q zsU Du` Rw \xk ryq zw {} }$ [ P f > @ l % I ^  ]/#a:#3  ! ,#arg# @ ,9 -U# .U# k/%# 0U# 1U# 2,# 3U# 4U# .5,# 6P#$ 7,#(B9 C ! >,#dir?# Q@,# bA,# wC2R%UOQUdQ aQcpSUS?T,pHU,lV,hQW,dbX,`j]ef1hcP_,XdpWnpUVn,TƑRPM֒U,PzG/HkK%VP|f:,P@npUVXn,p1,PPPnpUVU n6,16,P6PǕ5n,PݕRPn7,V17,P7PP%S1@,PAP!RPfn ,L9R,9P  ")9,#8,#8,sum:,$:%#TintP T I%J,MHNd$'low'#'#2 s0 ll1 2 "T n!VW d!PQ Κ#.9DOUZepV{RQWWPQ`RP Pndrpnnddrrd0d1n0n1n2q0q1bbmwwm1m0$TintP T I%J,MHNd$'low'#'#2 s0 ll1 2  T u8 vPQ w ʛ3!+x6ALWVbWmUxRPP loPRPndrpnnddrrd0d1n0n1n2q0q1bbmwwm1m0 ../lib/usr/include/sys/usr/include/usr/include/isotest.csystem.hstat-time.htimespec.htime_impl.htypes.hstat.hstdio.hstdio_iso.hstdio_tag.hstdio_impl.herrno.hversion.hexitfail.hctype_iso.hprogname.h)U,,VԸrk-ds)e*v:T:V/+]8,.KjWh-L^G$:ZH)'/=5*UuU 9-5Y}cz+1e?-$#>53+(*p G*5:rr"#?~r:}Ӹ*~G?~r:}*q G|#=~r`9VU[wUc="+RVUVUV>qV+ qqUV:IV6HqV5V8cVKkVp4V =VM4Xc=V V=V=Vu=Vd=V8V;K vUgxqrT:4 q'(uF,:rc F,:oG qBrrGuF,:[UXu%)rrrqUnGrciGGm9}G9}9MG5#yGc9}G*D}G9}9Mg_/,rGc9}GyGq$}şI8`+Wo mUGiU9cGHHT9 ~:)fi+ ctU 9VzqX 9vc c ctU#6dfg(s'UyU\fU # version.cE progname.c?" w+ 9: c /usr/include/iso/usr/include/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeversion-etc.cstdio_iso.hstdio_tag.hstdio_impl.hstdarg.hversion-etc.h?* G-<x# czqvUxyyzzzlU<6=hhd+% version-etc-fsf.c? /usr/include/isobasename.cstddef_iso.hA L(.I,y+sSX( U;GK t+WGU:h40:ŀmdqƚp9 /usr/include/usr/include/isocloseout.cerrno.hstdio_iso.hstdio_tag.hstdio_impl.hexitfail.hB*%d# &;yG) /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/includeerror.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.hdCc+U+Xdvsr* +#c9#  c +8:48:G R.(+f0d cɸ+Z*:%N;  euidaccess.cpEi$ exitfail.cM! hard-locale.cE$);eRX +T,0N.F,:5 quote.c,Fd1d; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.h\Frdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnG /usr/include/isostrndup.cstring_iso.h[Vb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h[ cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHFqCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.hy9:trsdrT:grq|qX ..D..Y.  .| 0?j .| `?^ C. . ...7. ..$XA  . HxAZ  ......| AFB'DDB` ....|  tB tB 4tB .V. .| 0dC  .4DDk ...<D $...| $pE  .| 0E .| $$ ,F  .$$ DF .| , \FE . F F, F\ X 0G$0 TG2 @, G, .< G" .. H., NG &. < O 9. .. $ O ., O .L pPQ V.w.  ... #.$ Q .$ Q .$ R .$ R  ., 4R- ., dR. .$ R  .$ R .8 RD . .$ S  .$ (S .$ @S  .| 0 XSR .| 04S  !.| 4|TT% ..4||T) ..4|T= '. .,|T$ .,| U  ..,|,U% .,|TU' .| |U  0|   Z | ,Z+ ..| ,<DZ  ..| ,dZm .| 0Z .| , [E  .| $P[1 .P\1  .V .../.. ..0A......6.o.;..2......| ,Xe .| $]  .| 8  | ,(^ A| Ll l | 0  *.| L  | L| 8t !z % usagec mainz J%Version4 ,set_program_name|program_namePS |version_etc_va version_etcfemit_bug_reporting_address(version_etc_copyright<4Elast_componentbase_lenbase_name`1Jclose_stdout_set_file_namezclose_stdout_set_ignore_EPIPEclose_stdoutry(errorverror_at_lineerror_print_progname)error_message_count;error_one_per_lineeuidaccessOexit_failurehard_locale$:quote_nquote1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals$umaxtostr%Erpl_vfprintfe'gxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdup1*Estrintcmp7,yNfseterr-xalloc_dieV.Exstrndup.Nclose_stream0rpl_mbrtowc42rpl_strndup3vasnprintfPDrpl_wcrtombTQVprintf_frexp Qhprintf_frexplSrpl_isnanl#QT printf_fetchargsWprintf_parse___udivdi3b__umoddi3)p ?jS ?ABdC pEE,F-\F $XSR%S'TT'1*|U7, Z -Z+V.DZ.dZm0Z42[E3[91PeTQ]QS^QTW _bzt$8 4 QU[f_clbf#jmlbp<vK]2Al`t64 o ~Y ~`c@ ` e T [ _| X#Q2O";. D]h};]g^|*^8U~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O(xT #0~T #0< m0#< mX#1u 5< AuFy0/"04D=?:<7979*.w GNU C 3.4.3 (csl-sol210-3_4-20050802)lbracket.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntpad_ptr_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned int__longlong_tlong long intoff_tshort intshort unsigned intu_longlong_tulong_tino_tblkcnt_tblksize_tlong doublemode_tuid_tgid_tdev_tnlink_ttime_ttimespectv_sectv_nsectimestruc_tstatst_devst_pad1st_inost_modest_nlinkst_uidst_gidst_rdevst_pad2st_sizest_atimst_mtimst_ctimst_blksizest_blocksst_fstypest_pad4test_syntax_errorformatbeyondunary_advance_Boolfind_inta_stringnumber_startto_ucharget_mtimefilenamefinfobinoptest_unopbinary_operatorl_is_lstat_bufstat_sparer_is_l_valuelbuferrbufxe_operatortimespec_cmpunary_operatorone_argumenttwo_argumentsthree_argumentsposixtestnargsexprtermnegatedusagestatusemit_bug_reporting_addressmainmargcmargvinitialize_exit_failure__iobsaved_errnoVersion__ctype_maskset_program_nameversion.cprogname.c/opt/pkgs/coreutils-7.4/libargv0saw_slashversion-etc.c__gnuc_va_listversion_etc_vaclose_streamcommand_namepackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cbasename.clast_componentbase_lenprefix_lenbase_nametmp_lengthcloseout.cclose_stdout_set_file_namefileclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageerror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineeuidaccess.ceuidaccessexitfail.chard-locale.chard_localecategoryhardquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsset_quoting_flagsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledquotearg_bufferbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimmbstatebytesleftquotearg_alloc_membufsizexcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_vals__ctypedefault_quoting_optionsslot0nslotsslotvec0umaxtostr.cgl_uintmax_tumaxtostrvfprintf.crpl_vfprintfoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupstrintcmp.cstrintcmpnumcomparedecimal_pointthousands_septmpatmpblog_alog_bfraccomparea_trailing_nonzerob_trailing_nonzerofseterr.cfseterrxalloc-die.cxalloc_diexstrndup.cxstrndupclose-stream.csome_pendingprev_failfclose_failmbrtowc.crpl_mbrtowcinternal_stateretcountrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_floata_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerUDItypedir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memoryoverflowbuf_neededlengthbuf_mallocedresulta_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharactersremainingtmpbufmaxlen__x_ntmp_memsizesign_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cprintf_fetchargswide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3/gcc/libgcc2.c/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3-i386-build/gccUSItypeDWstructhighDWunion__udivdi3__udivmoddi4__cbtmp__umoddi3.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.1.rodata.str1.4.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo@'   P /" 7oEodd*Ro  c P"P"Ho B"" s $ $ x@'@'pv~ННh 2hh2TT)||`pPPPPPPXX``44 88@@x <@!' | /G8oFpeRc%^kT{إx00 D0707011d719ce1000081ed0000000000000000000000014a5bb2cb0001e6380000012e00000002ffffffffffffffff0000001a00000000root/opt/aosug/bin/base64ELF<(4X4 (,+44o8 hhX/usr/lib/ld.so.1 !"$%&()+,./3479;=>?ADFHJKLMPSUVYZ[\]^_bdefhjknpqsuvxyz{|~  #'*-012568:<@BCEGINOQRTWX`acgilmortw} #.X) D) PYPcn|; <4 @ B )R2 DR, RR" k[Q ~xe J4P# Z&`,%j%qQ t^ $_$ P dZ 3m '<'tR$ ,'$` !  '$ B p;  N &U ?  L&s H] | @ isbase64fsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummybase64.cversion.cprogname.cversion-etc.cversion-etc-fsf.cxstrtoumax.cbkm_scalebkm_scale_by_powerbasename.ccloseout.cerror.cerror_tailexitfail.cgetopt.cexchangegetopt1.chard-locale.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsvfprintf.cxmalloc.cfseterr.cxalloc-die.cxstrndup.cclose-stream.cmbrtowc.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.sversion_etc_copyright__environ_lockxmemdup__longdouble_usedbase_namefwriteexit_failureprintf_frexp___Argvfopen64set_quoting_stylerpl_mbrtowcquotearg_style_memrpl_isnanlxstrndupusagestrchrrpl_optargquotearg_charerror_message_countvasnprintfmbsinitbase64_decode_ctx_initset_program_namexcallocVersionquotearg_n_memmemmovequotearg_n_style_memclose_stdout_set_file_namequotearg_freerpl_vfprintfbindtextdomainxrealloc__fsrrpl_optind_Jv_RegisterClasses_lib_version__fpendingprintf_parse_endrpl_getopt_long_onlybase64_decode_ctxquotearg_alloc__dso_handlequotearg_colon_mem_fini_exitxmallocxstrtoumax_getopt_long_r__fsr_init_valuefcloseerror_print_prognamefseterrstrrchrquoting_style_args_DYNAMICquotearg_memquotearg_colongetenverror_at_linequotearg_char_mem__udivdi3errno_getopt_internal_r_getopt_internalemit_bug_reporting_addressquoting_style_valsstrnlenmemcpyrpl_strndupxstrdupwctomb__iobmemsetlast_component_startclose_stdoutquotearg_style_etexterror_get_exit_frame_monitorfputs_GLOBAL_OFFSET_TABLE_strcmpset_char_quotingrpl_getoptquotearg_bufferbase_len__flsbufldexpx2realloc_getopt_long_only_rclone_quoting_optionsmemchr__ctype__register_frame_info_basesprintf_fetchargsstrerror_rquote_nsprintf_PROCEDURE_LINKAGE_TABLE__edatagettext_environclose_stream__assert_c99freadquotearg_n_stylebase64_encodequotearg_nrpl_optopt_mcountversion_etc_vaxalloc_diesetlocalebase64_decode_alloc_ctxrpl_wcrtombrpl_getopt_longabort__fpstartatexitget_quoting_styleerror_one_per_linerpl_opterrxzallochard_localequotearg_alloc_membase64_encode_allocwcsleniswprintset_quoting_flags__deregister_frame_info_basesstrncmp__1cG__CrunMdo_exit_code6F_v_version_etcfflushclose_stdout_set_ignore_EPIPEquoteargprintf_frexpllibc.so.1SUNW_1.23SUNW_1.22SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/lib y y y '=  (=  qN  7 XEtckaMi9Sz~j_m@bTPwRB{Hxeh7rDA)`<C]|Lf[5uv6=8O;Yl}IGq^;m&SXI`lV3m&vuĶ!ȶ^̶ж"Զ`ض{ܶ< k}?wz ofaE $(,0#4T8<O@(D:HNLrPTXR\ `gd]5%%h%h%h%h%h %h(%h0%h8p%h@`%ĶhHP%ȶhP@%̶hX0%жh` %Զhh%ضhp%ܶhx%h%h%h%h%h%h%h%hp%h`%hP%h@% h0%h %h%h%h% h%$h%(h%,h%0h %4h(%8h0%<h8p%@h@`%DhHP%HhP@%LhX0%Ph` %Thh%Xhp%\hx%`h%dhjjht Rhptt PEu TRU RP"y PPv~URQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS['R8t :4ҋ4u鋃t Pƃ8]ÐUS[ˌP$tSj<PP0t,t 0Pq]USP]t,P5ܹPhVZYPhY S5ܹh)$AYXhh$8XZhh$YXhh|$XZhh$ h Q5ܹ=YZPh$ h:h6hȱ}$XZhhd$$% 5ܹZYPh<*$BUWVSLu 6}ƅDžLDž XZhjYXhDh:1$:$@9 jhh\VW6$ dtmiw jPjj5pr t 5p0Pha$ Pjji jhh\VW# j()H~b 4$Phw PjjZj:ƅ=}j=~t jԃ j 9;8Dž`Dž1 )PjPgQ ƒu u vuw¨u u t t t! h P5Xj @ j V<WSVP Dž91ҋ)ӃwVwQÉ+9vÅuDhhDž9rS hSjP9s! h\ P5XjODžjh5h6hh h P5Xj( P1)PjPtz1ۅtt9spT=艕ރ P1= PH)P؍PRPt9rQ  w 11v PۍPDž t1PRQ hjƍP;rWt2CQ uvvC h5 Pjj,믃 h P5Xj 놋뗃 h P5XjS h^\hҬ5XjB5wA$ܤhФjShbh} }E봋EMUE܉Qe[^_úEU E܍8tMEUMQE܍e[^_ËUPu?EEi{BE jEY j j j1?+ j j뺃 j볃 j묺ve[^_SD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$V e[^ÉP</ZtPS e[^Ív@PSD$ÉD$ÉUh ta=t =X tO hNtM P RPhά5Xj" P h7 uÉPhҬ5XjUWVSu uhlu?H  huue[^_ÉRhSVt hlGƒPRhЬhAHyvhj mw WUh,xtЃEPuU EQ5ܹhhEPuU EÐUtVSu]t95t\5 hxtSVStjPhG[^EPuU EGe[^Ð9tSPutP5ܹhhVSuUWVS T$ƋB D$D$D$R$9Љ$D$D$~\D$9‰~RT$,$+$+l$9T$~`19}'D$)D$ L$T$ G9|)l$$9D$YD$+$D$T$B D$B$ [^_]Ív1L$$G;|$|T$$T$9D$~T$9JUWVSlE$@EU::rUҸQM$A FE$X$X u@E }$1ۅDU$ZM<-X<+ 1U$BM$uA}$}t ?XE$U$@$9؉E~]Z$M$A 9~؉Y }$;]U 4u7U}$9W C9tE }E$U}x$;]H} :-M$yt CQ e[^_ÐAE$X$X u@E 1ۅ hU$ZM<-FBBiu1Ʌt<-u| E$x}]5U$M B<-tMz}EEEE}t<=t EUuuEM+MMԍvPuu6u>>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PuEM$@A}VuuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7WhrZYPhuU$?r뵋Et)M x-t}PuPEtBU x-+ U$rPM 1Sh(ZYPh }$E$U$@C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2PhH^_PhUȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1Qhh+_ZPh.}$ }1}ыELU$JMA B?C}]ȉ}EE t0ShZYPhU$RUCVE 0ShZYPhcut$E t0Sh[ZYPh^M$Q׊EэLE$HU::M 41Sh֭ZYPh}$GE!VE 0ShZYPhN]M$Q1ыE$LH?}71Wh[^PhE$@ESuuTE$P1ыE$LH?}7E 0Qh_ZPh"MM$} 47ShHZYPhUhu uuuuu (u$( p  ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuVtw P7tehVtSPt(hVtSPu1SVt$ e[^_U u ju UujUS Xj(EtP`X]É@PEX]ÍvD$tÐ@ËT$tD$Ð@D$VSL$T$ ҋ\$tt11ډ[^ÐH11ډ[^ËL$t AT$QÐ@AT$QWVS0Í|$1$D$߱ 0[^_ÉUVS PÉ9te[^ÃuUWVSl1ۉE=hEE}UEEEEE$EEE} PM 9M}tF}t?EE;E w4MMuM9΋}Mu};]sE\CUM ƒ~Uw$$}EaWEE}}UU;]s EuMECE}tW}uQ}D;]sM\C;]sE0uC;]sE0ME0CEMA9r;]vCM} EU<};]UMsU?C;]sM"C;]su"C;]sE?C}u U}JtLU)EMuNut}<;]sE\UCJ;]7UuC)1}} EEuuUȋE R)MPPEPx tJ}t}t; uNuE UR}Dt}9sEMȉEEE[!w $ vB9r댋M }EIM /a}W}M jeuuu uUEO e[^_Ã} } 9M.}$}u}'}E}uuNA}}U;]C;]su\C;]E'C}r}EM;M suE|?bTƒ!O$vr}}6Eifb}};]su\MAC;M s,UMD ;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]surUSPMɋU t1 APq1uXuEX ]Ív@ȐUWVS}MXWɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU XtUEe[^_ÐU덿@nUuju uBÐUVS;458s t C;4rF=t P,0,t V8,4e[^ÍvUWVSƅXUE8#954wyV,EUE}PPT}ã8t,0S=4M)1<E4E UP|PRE؋E 0uUuUi 9EwI@Et W u_Duu܋U 2uuU EXe[^_É1svUh@EU jÍvUh@uEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<}@ EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUWVSuu PP}DžƋtRWSjP59rۉx1e[^_Í9t XVWXXO W4US]St]ÅtvUS ] Sut]ÐtvUSR]M ۋtsB‰U ]X[u@vUS]S\ SjPx]Uu uot]US] S SuPS]ÍvUW U1QR}D$H UhPhҬjPUu u?tUVSuVE^ 4$%ut+}u =X tu Xe[^Ée[1^UWVS u ]}tmtb Wu0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt tJu0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ pfX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 <螟MBDž$4$w $ DB9s$9uʁ,w , DB9s9Ӊ,u8fQ8@W/K}09 d I]PS 6xW #8;8s;<< t&<;8-3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @RLt L7 u)|1XXDE |nKI;w0CJu +  1ۃ؃w ICNCFC? <2 <) P.Dq(L؉,!8Q8@VЙ0CutbC0COuDA$C+C0C0CKI;w CJuNAAAN<ٽnfnffl٭l۽-CEE@uv؋DB$A<ICNCFCffj٭j  ٍxP <$+E@DB$o8fW8@V5KIE9@+nFaFn7eE0CuNC0COu+ICNCF^ I0CutC0COuDA$C+C0C0N <”{iCnCf+ <蟔e tsti;vLIJ8JP8@V萕/ PUyG0AO󋕸IJ;w AOu8P8@Sv0C:1twC!0CN@m <JVQ耔z@o88W8@Sy|=8P8@S2~ <ܒOUSPE]t P輓t5۸tu SPx]XX]øXUE Pu uMA=E|EÐPP$EEUWVS۬$0|$f|$fD$ l$ 11x|$1vɉۺۺA tم~8I ۪Iu۪Ʌf|$ l$ $<[^_]1x|$;ۺۺA ɉ)Ł}EuJ~?II)Ń |*Ʌ#L$(D$ L$$D$T$$%T$u D$=tD$ÍvD$5 $UWVSl$E1t$]t#wP$\CG9}w[^_1]ÉPCS܉fCωC[^_]ÉHP CSK 롉uC덉{C@rUWVSHE ]EEEEj,U B} MEAQ CC%uU M PAE 21 EEEsEEc E %E EF9sE_;UlURU> P P uEEG E.EE E PwEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt P艅X AURU P[UWV T$(t$|$ D$$҉t$ʼn$u9vGD$ 1^_]Ív9<$v1v$ǃuA;4$w19l$r̹Őu 11ʼn1NjD$ ^_]ø )D$$L$ ‰$L$D$L$ Ɖ4$d$9wB;D$8I2UVS[bp@Ћu[^US[/O[US[ӆ[$d+w0i?~D}>?456789:;<=  !"#$%&'()*+,-./0123ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/P;@;0;#;; ;::::Copyright %s %d Free Software Foundation, Inc.xstrtoumax?==>=>===>=>==>===>====>>=======>>===>===>=>======>== >LTZjgowvIS~XXXXESXXWSSSSSSKXWpXRXwXWWSSSSSSSSSSSSSSSSSSVVVVVUV WVVVUUUUUUUUUUUUUUUUVVVVaWSUUUUUUUUUUUUUUUUUUUUUUUUUUVVUVUVUUUUUUUUUUUUUUUUUUUUUUUUUUVVVVVVPVVPVVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVPVVTUUUUUTTTUUUTUTUUUUUUUUUUUUTTT{clclcl{{{clclclclclclclclclclclclclclclclclclclclclclclclcl{clclcl{{{mmmm n{{{{.n*n.n{.n{o{{{?{xxxx\z\z\zzxxxxx(NULL)ϖÖÖٖ                           x  xxx                       x xxx     ɞ  C   bug-coreutils@gnu.org Report %s bugs to %s GNU coreutils/opt/aosug/share/localediw:invalid wrap size: %sextra operand %s--read error%s %s write errorSimon Josefssonbase64invalid input%s: %sclosing standard input/.libs/lt-%s (%s) %s (C)Written by %s, %s, and %s. Written by %s and %s. Written by %s. Report bugs to <%s>. xstrtol.cUnknown system error%s: %s:%d: %s:POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous CPOSIX"'`memory exhausted%#.0f%+d(NULL)decodewrapignore-garbagehelpversionliteralshellshell-alwaysc-maybeescapeclocale7.4Try `%s --help' for more information. Usage: %s [OPTION]... [FILE] Base64 encode or decode FILE, or standard input, to standard output. -w, --wrap=COLS Wrap encoded lines after COLS character (default 76). Use 0 to disable line wrapping. -d, --decode Decode data. -i, --ignore-garbage When decoding, ignore non-alphabet characters. --help Display this help and exit. --version Output version information and exit. With no FILE, or when FILE is -, read standard input. The data are encoded as described for the base64 alphabet in RFC 3548. When decoding, the input may contain newlines in addition to the bytes of the formal base64 alphabet. Use --ignore-garbage to attempt to recover from any other non-alphabet bytes in the encoded stream. %s home page: General help using GNU software: Report %s translation bugs to License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . 0 <= strtol_base && strtol_base <= 36%s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous ?A=@??h"%2%B%R%b%r%%%%%%%%%&&"&2&B&R&b&r&&&&&&&&&''"'2'B'R'b'r'''''''''(("(2( P p    x  `8`p ``x!`ooo|#<#o`o``,(~?,zR|0 L  H8x 0 x! <# |# % <( Pplh<<<DL !"#$%&'()*+]|c -@U `gs~<<DLX) Ĺ) )2`?)I M @Vao; <4 Ф  @ (:ENB W(cm{,48@(R2 R, R" [Q $.8EP_iFz : ; I : ;  : ; I8  : ; I 8 $ >  I : ;I : ; I8 &I I !I/ .? : ; ' @ : ; I 1.: ;' .? : ; ' I@ 4: ; I 4: ; I 111  U41  U411 .: ; ' : ; I : ; I!4: ; I"4: ; I# $!I/%4: ; I? < &5I% 4: ; I?   I&I$ > % $ > : ; I$ >  : ;  : ; I8 I!I/  I .? : ; ' @ : ; I : ; I 4: ; I 111&I.: ; ' I : ; I.? : ; ' I@ .? : ;' I@ : ;I .? : ;' @ : ;I 4: ;I  U U41  41.: ;' I : ;I!: ;I"4: ;I# $ %4: ; I % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > $ >  I: ;I&I : ; ( : ; I .: ; ' I@ : ; I : ; I 4: ; I .? : ; ' I@ 4: ; I 4I4    UI!I/ !4: ; I? < % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < % $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 11 U4141  U .: ;' I : ;I4: ;I 4: ;I  I&I3*'0NS*7S*Z8#`9#k;#q<# w=# ~?# @ # A # B # C # D # intU[,c %  ( D5A#F#r# val#  %N! i"# buf## % /1d5*o+Uj4S1C*F*qnp+3UWVoptPGGSGfG S-.G$G/G:_EV8QPZ~[.a.hGpS/1/1_$G/W:GFVPGYScSR\inout f!!\!m"sum#"n m%$/ ~%$/g elene ff foutf!h#!sf!.toinout !m!\"sum"ctx#"ok"n"k#"i , /;%7o%=rR%H%Y :%_ %g &%x   / r( F0330_7=BNW93'intP7lN!i"7#buf#l#||N    |G33T inE|W E,V outFS F,Q H :0343Q`3d3h3333 |?<ch; u,3Q4U int| t,V outt  v,S :-:T4f4Tch,h4h4s4Tctx3hP E:t49Uctxhin| ,out),p1:oA:nK7htQ,d45Wp=5?5558^|\e|W6k6 x(V16k64R96W6?67SG66^M7O77788 ,lx: inv|!v,!uw!)w"outy LzC ctx@h inAL!^A|!B#3"tI|$"pU|$"cX |):99Uctx&hin'| ',Vout' S(W/,p|%b64  :9jt#9:U"jS)jl*jppuN xjܹ;:+06NU%S*S S*Z8 #`9#k;#q<# w=# ~? # @  # A  # B  # C  # D  # intU[Hc    +:n;U (p )Q )l *W $*= ",9S .:D: ,0=R.6 f8p;;U    $=q;;UHK;7yD;;ZNint  O.%Dy ?;lintN O ( dOy y' 0;}<U x/l /%V [A<<U x@p l@%W @%S errBVQ"M<?U sKV ptrKQ eK%S valL -L_Nrl pOQW tmpP` errQ\<gФ"<= qYR chZHQl%V3%XEPrgA WwHNjlY:%0L? ?VintP7a! ?f?TA l"Pp#Q$S N  pp,h??TAoRlenq,P yr, <K??UAJVlLSM,P-@?NS*7S*Z8#`9#k;#q<# w=# ~?# @ # A # B # C # D # int   o*??T )oPu % O?@T N l@@U  poPY:,;7g  $o .uB@+06NU%S*S S*Z8 #`9#k;#q<# w=# ~? # @  # A  # B  # C  # D  # int 6   @AU j W  V ' ;= A[A R w6j i sk@n(65vAAU j    ';=GABUj   SY V';=U e7#xz: l  t^H5; 7N xaXN  BBintN  g%  1PBintN O S*JS*Z8%#`9J#k;J#q%OPU;%; {;<<=%$=% ?%PX%P1PUW%W {W  r#$A;%7&=Frp&HU%(&Z%$&`% d@ + P4P$intN O 5A#F%#r#val%# O% U   (!H%%#&%#'%#=(r# -%# 5r#W#"[%#4d%# Ce%#$ .*%4PWPU (% ( ( ) >)r qH3%XP~PU 0% 0 0 1 >1 d2q A%PPU >% > ? @ >@WJ%PPU G% G G H >H dIq`  pQPk+Nint  y%PpQU$9V&Wp'P PcQ~2%S +  QpQintpppQQUn%Ap v{N &pQQUA%p- q^QintP7GI! / E D N  Z ( ,# % Z .\ 7Wl ( 1P# 4%# 8W# g7   r s,#valt#f ^QQUo]e_%Sp`  iPQQToh, qQRTopspPP |%RtRTo{Rc{i{%Suc}Qp~V %Qr%P| %tRRToQi%Rr%P   RRTPRo JJRRU JSsPV JPPN ,RZU@- ,argJ8 , P % Ni,len,S@ JM ,^ Yp Y Y 1V rW mW !`U CUcescPm, Y TT ,R Hw>D ,W)VWVj,RXSY,JVTJWT7F,ZcZU C - C,R!argDJ 8 D,!oEpGQeH%SrI,P  `dZ [U!arg^J 8 ^, ^!o_paWeb%p d%l e,S"bufg#ZZ$,% &n,  S ['[U!argQJ 8 Q, !oR';/ ([[Usv;Vi7Sg(9= []U!n%V!argJp 8 ,  e%l"n07sv;SHn1,hP YgY\\ ,`valW %\ ,P#\\$p] ]%]U!n%P!argJRh (]F]U!n%P!argJR 8 ,w H]]]U!argJ  `]x]U!argJ 8 , o  x]]U!n%!sPR!argJoH  ]]U!n%!sPR!argJ 8 ,oH  ]]U!sP!argJ Q  ] ^U!sP!argJ 8 ,   ^P^U!argJ 8 , !chP    P^j^U!argJ!ch   l^^U!argJJ  ^^U!argJ 8 , Z Z J)  ; K <S U =P Y:a4aa intP7GIN  Z (,#%eZ .\  pk C,4aaU pwcBp sBvV nB,S psBW  w O  Y,l  wc\>p ret],P>|P9ba ?0intN Z  }a9bUsVn% len%Snew}P ZFuO#dir?_# @O# AO# CZ B 6pparg~ HPV  Rpp!ppPpq!pqP arg[ \!IqMq&] h pad ORend sV!qqq sQ   OS #n Ogr(r!r(r"  O` sW 2sls, O1 8j H lsrs$l %=l %Dl _ml w` J HxS ] \ HPYYuuk\!u u"vq argY HP uuargy HPuu!uuPuv!uvP arg\!Xv\v&;padORendsV8#nOyvw!vw"`O`sW w)xRwxQP Sxxo RXxxQPKxxQPcargR#nOyyRyy!yyP8O`sS \zzargyRS`arg RST7argMZRTarglRS p{{argGHR {{argAZR {{arg;HR \q OR\ HPEbO$g}}R!~}}P0O`sS]Parg ] wn, O8H!$%=%D_mw p bufw ~ x HP "2nOV0n Ox`ft`"x O` sV"Ăӂ!Ăӂ"8 Hv V bh_cw x .o| x m$]  %= %D p_m ;y!|R x q sQ bj RdQP ( R΄QP(J HxS ]P \q ORh\ HP\ HPQP <jR-QP  buf ~  HWqՇ!Շ"(% O`% sVP"%!%"8h#wOpadOW4!P#nOHQ++!P!+PO`sS#rppsQendswswP arg ] jqsQ 'qsQ?h8 Hv w ?E_cw x Sc| x $ck$  %= %D p_m y!ˎ|xUqsR o.Tq sR nOV!Ғ`<sPO&NO'MO'MO'MO'MO&9O'8O'8O(sum:O+6?<6)*Y*H+x)*H+x,& &XO'WO'WO&DO'CO'CO'COs-Y :H@t ݓxintP7GIN P Z (,#% eZ .\  0,xݓU sS wc> ps0P  ret+%PY:%35!= intNB:=UxA:[ APJC,|,!@ intNBa !B%@TxA%\ APJC,SvDVW QU _cwFV Zh|FV C/X4Y iZ,Q }ٔ9a%]@b%[ _|V 29|%[@}%] ,%H?n'"^Gint` D>D`EDg w%3PDA ^H:^T xG` PQR mSw JT%P" `iintP7GIu[aNUP   cIK2         % 7 C S ]lxX \  "`\ *ah 2b :c Cd% Ie7 PfI Zg eio sj lc mj n Lo% q sq u| w x y z { }w a >\%Io  ;]K#aV#@  ,#arg#Io/%%` T;$vVa$oUi&,Wap'S wp@ u.# intP7GIN   cI/2         % 7 C S ]lxX@  "`@ *aW 2bl :cs Cd% Ie7 PfI Zg ei^ sjz lG mN n Lo% q sU u` w xk yq zw {} } [ P f > @ l % I ^  ;]/#a:#@  ,#arg# I ,9 S-U# ].U# /%# e0U# q1U# {2,# 3U# 4U# 5,# 6P#$ 7,#(9 C >,#dir?# @,# A,# CR% U QUdQ aQcpSUST,pU,lV,hW,dX,`Ij]YeƠ1cP_ ,XdpW|npUV|n,T&MR@MPM6,PzH;G/H K%Vܙ:,PnpUVn,,P`PP\P\PnpUVU0 n6,X6,P`6P'n,P=dRWdPxn7,V7,P`7PP%@,P`AP!RP\Ơn ,LrRP  "9,#8,#8,sum:,$Y:%J&intN  3I%2J,9MH8Nd:'low'#C'#2 s0 ll1 H2 P"T n!VW d!PQ .L#.9DOUZepV{RQWWPQRPhlPZndrpnnddrrd0d1n0n1n2q0q1bbmwwgm1m0, /usr/include/iso/usr/include../libbase64.csystem.hstdio_iso.hstdio_tag.hstdio_impl.hstdint.hbase64.hgetopt.herrno.hversion.hexitfail.hprogname.h*4GHH{9d:)fi|) s+As /usr/include/isostrndup.cstring_iso.haVb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHFqCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h`$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.h y9:trsdrT:grq|qX. .P.  .. .". .. .<. .". .| L3  03m 7. T4 h4 8t4 x.].<9 .$. *.| 0 9j .| `T:^ C. . ...7. ..$Tp;  . HT;Z  ......| 0@; .(@<4 <@<i R..S.|  ?Fh?'D?` ....|  ? ? 4@ .V. .| 0@  .4Ak ...<A $...| 8B 4C  . ..". .t. . .U. .. . d. .". .#. .@. .$. .M. .W. . . .$Ob 1. $P! . | $D4P# . $DXP& . $DP# . $DP& . | 0P .| $@ pQ  .$@ Q .| , QE . Q Q, R\ X tR$0 R2 @, R, .< R" .. H., ZG &. < dZ 9. .. $ [ ., ([ .L [Q V.w.  ... #.$ ] .$ (] .$ H] .$ `]  ., x]- ., ]. .$ ]  .$ ] .8 ^D . .$ P^  .$ l^ .$ ^  .| 0^  !.| 4PD_% ..4Pl_) ..4P_= '. .,P_$ .,P_  ..,P`% .,PD`' .|  l` | ,x`+ ..| ,4`  ..| ,x`m .| 04a .| ,aE  .| $Hrpl_optindPrpl_opterrbrpl_optoptf Drpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_r$hard_locale$$:quote_nquote%1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals1Erpl_vfprintfe4gxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdupx6yNfseterr7xalloc_die8Exstrndup69Nclose_stream:rpl_mbrtowcu<rpl_strndup_=vasnprintfQZDrpl_wcrtomb[Vprintf_frexp 4\hprintf_frexpl]rpl_isnanl#^ printf_fetchargsbprintf_parsei__udivdi3*U3F 9j :/;1 ??&@ 7Bu  4P$P$pQ-%Q 1^4D_'x6l` 7x`+8`69`m:4au<aE_= G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O(xT #0~T #0< m0#< mX#1u 5< AuFy0/"04D=?:<7979GNU C 3.4.3 (csl-sol210-3_4-20050802)base64.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntt_ptrstrtol_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned intlong long intsize_tshort intshort unsigned intlong doublegl_uintmax_toptionbase_namehas_argbase64_decode_contextusagestatusemit_bug_reporting_addressmainargcargvinput_fhinfiledo_decodeignore_garbagewrap_column_Booldo_encodecurrent_columninbufoutbufwrap_writequotearg_bufferwrittencols_remainingto_write__iobrpl_optargrpl_optindsaved_errnoVersionexit_failureset_program_namelong_optionsversion.c/opt/pkgs/coreutils-7.4/libbase64_encodeinlenoutlenb64strto_ucharbase64_encode_allocisbase64base64_decode_ctx_initbase64_decode_ctxoutleftignore_newlinesflush_ctxctx_ioutleft_savein_endnon_nldecode_4outpget_4n_non_newlinebase64_decode_alloc_ctxneedlenprogname.cargv0saw_slashversion-etc.c__gnuc_va_listversion_etc_vaclose_streamcommand_namepackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cxstrtoumax.cstrtol_errorLONGINT_OKLONGINT_OVERFLOWLONGINT_INVALID_SUFFIX_CHARLONGINT_INVALID_SUFFIX_CHAR_WITH_OVERFLOWLONGINT_INVALIDbkm_scalescale_factorbkm_scale_by_powerxstrtoumaxvalid_suffixes__func__overflow__ctypebasename.clast_componentbase_lenprefix_lentmp_lengthcloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineexitfail.cgetopt.cREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optopt__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptexchangebottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlyprint_errorsnameendpfoundexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalresultrpl_getoptgetopt1.crpl_getopt_longopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsset_quoting_flagsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimmbstatebytesquotearg_alloc_membufsizexcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_valsdefault_quoting_optionsslot0nslotsslotvec0vfprintf.crpl_vfprintfformatoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupa_stringfseterr.cfseterrxalloc-die.cxalloc_diexstrndup.cxstrndupclose-stream.csome_pendingprev_failfclose_failmbrtowc.crpl_mbrtowcinternal_stateretcountrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_floata_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerUDItypeargumentargumentsdir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memorybuf_neededlengthbuf_malloceda_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharacterstmpbufpad_ptrmaxlen__x_ntmp_memsizesign_value_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3/gcc/libgcc2.c/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3-i386-build/gccUSItypeDWstructhighDWunion__udivdi3__udivmoddi4__cbtmp.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.1.rodata.str1.4.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab o o88@4' x x 0 /" 7oEo0 0 FRox!x!c <#<#@o B|#|# s % %0x<(<(z~PPpph 2z2llhhX|<<<<<<DDLLl  p!' 0X /8B=FlRqj-'^tk}{109o 0707011d719d31000081ed0000000000000000000000014a5bb2cb0001b1f00000012e00000002ffffffffffffffff0000001c00000000root/opt/aosug/bin/basenameELF%44 (,+44oXXXX $$X/usr/lib/ld.so.1  !#$%&'*+-/2345679;=?BCDEIMPRSUVXZ^_`acdfghjloqrstuvwx{|~"(),.018:<>@AFGHJKLNOQTWY[\]beikmnpyz} #.& D8' P[ePp{t, . >2  ?, L?" 'HQ :GR\ftP1  #& <M)v RJ f#k'c q;# <& Є DJ X&~ `JD <,+' P$"` G#dPE L ԩ/>$ AL) J  W up/  I- ܡ%"P1 $XB$<> K% ةe #!J 0,J ?EP] R`#ZM  = $bns M^ L% 0$̩P%D<# @$J? %+  -3$@p#HT-k N=E dlN  y#~#$+  C##ܩT+` x*j $%N+ O " p%Щ I. !#+\I 6% = %D& L,L= VСh$!op^ z ;0K ;! 4Om $m$%*F 4= p|G < p;b   ءe %%+:#  !DI Q b@%j`G yF X- $$ $0%h<& /L% #$|I NZ 8>J O L`$S q~ԡA#pFG p$L' + I = lL$ P> l>\ `%basenamefsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummybasename.cversion.cprogname.ccloseout.cerror.cerror_tailexitfail.cgetopt.cexchangegetopt1.chard-locale.clong-options.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsstripslash.cvfprintf.cxmalloc.cfseterr.cversion-etc.cversion-etc-fsf.cxalloc-die.cxstrndup.cclose-stream.cmbrtowc.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.c__do_global_ctors_auxcrtn.sbindtextdomainquotearg_colon_mem_exitusagerpl_getopt_long_getopt_long_rprintf_fetchargsquotearg_style_mem__fsrquotearg_char_memset_program_namebase_lenstrncmpatexitquoting_style_valsrpl_strndupxcallocerror_one_per_lineset_quoting_flagsxreallocprintf_parse__1cG__CrunMdo_exit_code6F_v__getopt_internal_rquotearg_n_styleexit_failure_get_exit_frame_monitorvasnprintfquoting_style_args_GLOBAL_OFFSET_TABLE_get_quoting_stylexmallocerror_print_prognamequotearg_colonquotearg_styleerrnoprintf_frexpgettextfseterrrpl_optopt__iobversion_etc_va__register_frame_info_basesstrcmperror_message_countsprintfrpl_getopt_long_onlygetenv_edata_environstrip_trailing_slashes__fpendingclose_stdout_set_ignore_EPIPE_finimbsinitrpl_vfprintferrorclone_quoting_optionsversion_etcquotearg_freestrrchrclose_stdout_set_file_namefputs_endbase_namefwritewctomb___Argvxalloc_diexstrndup_PROCEDURE_LINKAGE_TABLE_wcslenrpl_optargquotearg_n_style_mem__fpstartquotearg_n_startfclose_mcountx2realloc__longdouble_usedmemsetrpl_isnanlprintf_frexplrpl_getoptclose_stream_DYNAMICabortmemcpylast_componentparse_long_optionshard_locale_getopt_internal_Jv_RegisterClasses__ctypeVersionrpl_wcrtombldexp__environ_locksetlocalequotearg_mem__fsr_init_valuestrnlenquotearg_allocquotearg_alloc_mem_etexterror_at_linefflushiswprintrpl_opterr__flsbufrpl_mbrtowc_getopt_long_only_rversion_etc_copyrightxmemdupstrerror_rquotearg_n_mememit_bug_reporting_address_initquotearg_charstrchr__deregister_frame_info_bases_lib_version__dso_handlerpl_optindquotearg_bufferxstrdupclose_stdoutquoteargquote_nxzallocset_quoting_styleset_char_quotinglibc.so.1SUNW_1.23SUNW_1.22SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/liby y y '=  (= ( qN 1 7A :52z=yukoI67e[pQEJV9;U3iRFCZ_q~B'MX8Gl@NO}K]<WcDSxst|0jb&kdhSlp#x0j(=pEFABy|1ğ5ȟ ̟Пԟz؟<ܟcJCZ+d9V}t3 PK/n 5\%`%dh%hh%lh%ph%xh %h(%h0%h8p%h@`%hHP%hP@%hX0%h` %hh%hp%hx%h%h%h%h%h%ğh%ȟh%̟hp%Пh`%ԟhP%؟h@%ܟh0%h %h%h%h%h%h%h%h%h %h(%h0% h8p%h@`%hHP%hP@%hX0% h` jj$t Rhtt PEu TRU RP"i PPURQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[sxRt :ҋu鋃t Pƃ]ÐUS[xP$tSjPPt,t P]USP]t,P5<PhZYPh S=Q5<5<h@u$XZhhl\$YXhhؗC$kXZhh*$R 5<5<h@ $! hQ5<qYZPh0$ hKhGh$XZhhԘ$$ 5<ZYPhn$UWVS u 6}\Y[hjvXZhUhKu$Ky$+jhmh'5ءhGh}VW$jjhVWo uFB9>B9}A t)Ph PjjXj h׃ 4a$E B9t uXu$E8/t1}tы}T9ىэL1;Uv9v IJ8t;UvUWVSj/]Sd]t@EE)؃~0uu]𿱝uv<e[^_SD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$V#e[^ÉP</ZtPSu#e[^Ív@PSD$@ÉD$DÉUhX#ta=Dt = tO h^@tM P RPh5j" ܡP h"uÉPhŝ5jUWVSu uh̩u?H  h1uue[^_ÉRhSVt hȝWƒPRhÝhQHyvhj w WUhةtЃEPuU EQ5<hݝhEPuU EÐUԩVSu]t95Lt\H5L h ةtSVStjPhW[^EPuU EGe[^ÐH9tSPtP5<hhVSuUWVS T$ƋB D$D$D$R$9Љ$D$D$~\D$9‰~RT$,$+$+l$9T$~`19}'D$)D$ L$T$ G9|)l$$9D$YD$+$D$T$B D$B$ [^_]Ív1L$$G;|$|T$$T$9D$~T$9JUWVSlE$@EU::rUҸQM$A FE$X$X u@E }$1ۅDU$ZM<-X<+ 1U$BM$uA}$}t ?XE$U$@$9؉E~]Z$M$A 9~؉Y }$;]U 4u7U}$9W C9tE }E$U}x$;]H} :-M$yt CQ e[^_ÐAE$X$X u@E 1ۅ hU$ZM<-FBBiu1Ʌt<-u| E$x}]5U$M B<-tMz}EEEE}t<=t EUuuEM+MMԍvPuu6.u>>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PuEM$@A}VuzuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7WhZYPhU$?r뵋Et)M x-t}Pu@EtBU x-+ U$rPM 1Sh\ZYPh }$E$U$@C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3%u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2Ph|^_PhUȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1Qh;_ZPh>}$ }1}ыELU$JMA B?C}]ȉ}EE t0Sh̙ZYPhU$RUCVE 0ShZYPhcut$E t0Sh̙kZYPhnM$Q׊EэLE$HU::M 41Sh5ZYPh!}$GE!VE 0ShZYPhN]M$Q1ыE$LH?}71Wh[^PhE$@ESuuTE$P1ыE$LH?}7E 0QhL/_ZPh2MM$} 47Sh|ZYPhUh`u uuuuu u`d`lЩh ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuVtw PtehSVtSPOt(hUVtSP)u1SV$e[^_USP}t]É jh hu jy tht)vu E Puuuhaj[ jUU u ju UujUS j(EtP]ÉP]ÍvD$tÐËT$tD$ÐD$VSL$T$ ҋ\$tt11ډ[^Ð11ډ[^ËL$t AT$QÐAT$QWVS0Í|$1$D$߱ 0[^_ÉUVS PÉ.9te[^Ãu[UWVSl1ۉE=ȩEE}UEEEEE$EEE} PM 9M}tF}t?EE;E w4MMuM9΋}Mu};]sE\CUM ƒ~Uw$Đ}EWEE}}UU;]s EuMECE}tW}uQ}D;]sM\C;]sE0uC;]sE0ME0CEMA9r;]vCM} EU<};]UMsU?C;]sM"C;]su"C;]sE?C}u U}JtLU)EMuNut}<;]sE\UCJ;]7UuC)1}} EEuuUȋE R)MPPEP tJ}t}t; u>uE UR}4t}9sEMȉEEE[!w $vB9r댋M }EIM /a}W}M jeuuu uUEO e[^_Ã} } 9M.}$}u}'}E}uuNA}}U;]C;]su\C;]E'C}r}EM;M suE|?bTƒ!O$Hvr}}6Eifb}};]su\MAC;M s,UMD ;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]su2USPMɋU t1 APq1uuE ]ÍvȐUWVS}MWɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU tUEe[^_ÐU덿nUuju uBÐUVS;5s t@C;rF=t P!t Ve[^ÍvUWVSƅUE#95wyVEUE}PP}ãtS=M)1<EE UP|PRE؋E 0uUuUi 9EwI@Et W u_Duu܋U 2uuU E죸e[^_É1LvUhEU jÍvUhuEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<} EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUVS uV8u S:e[^UWVSuu PP}Dž~ƋtRWSjP59rۉx1e[^_Í9t V7O W4US]St]ÅtvUS ] Sut]ÐtvUSR]M ۋtsB‰U ]X[u@vUS]S\ SjPX]Uu uOt9US] S SuP3]ÍvUW U1QR}D$H UWVS EuEEEM }1ۍV Cu  WuQhau hhm PhuXZuh$ w$ uhlE EEe[^__ uhփ uhܛɃ uh 뼃 uh8믃 uh`뢃 uh땃 uhq눃 uhx uhhOWuhuUEPuuu u Uhh$ hKhGh$XZhh؜$UhҞhPhŝjܡPFUu u?tUVSuVE^ 4$ut+}u = tu e[^Ée[1^UWVS u ]}tmtb Wu0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt DJu0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ @fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 <袯MBDž$4$w $ DB9s$9uʁ,w , DB9s9Ӊ,u8fQ8@W3K}09 d I]PS 6xW #8;8s;<< t&<;8-3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @VLt L; u-|1XDE |nKI;w0CJu +  1ۃ؃w ICNCFC? <2 <) P.Dq(L؉,!8Q8@VԨ0CutbC0COuDA$C+C0C0CKI;w CJuNAAAN<ٽnfnffl٭l۽-CEE@uv؋DB$A<ICNCFCffj٭j  ٍxP <$+E@DB$E 21 EEEsEEc E %E EF9sE_;UlURU> P P uEEG E.EE E P{EEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt P荔 AURU P_UVS[p@Ћu[^US[Ïc[US[o[hv &.-?DDE E?8E8E6D(@(@(@(@(@(@D2DDDD.DD(@(@(@(@(@(@(@(@(@(@(@(@(@(@(@(@(@(@'C'C'CC'CUA'CtC'C'C'CUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUA'C'C'C'CC(@UAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUA'CFCUA'CUA'CUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAC'CCCBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBAUAUAUAUAUAAAAUAUAUAAUAAUAUAUAUAUAUAUAUAUAUAUAUAAAALN General help using GNU software: Report %s translation bugs to %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . bug-coreutils@gnu.org Report %s bugs to %s GNU coreutils/opt/aosug/share/localeDavid MacKenziebasename+extra operand %smissing operand/.libs/lt-write error%s: %sUnknown system error%s: %s:%d: %s:--POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous CPOSIX"'`%s (%s) %s (C)Written by %s, %s, and %s. Written by %s and %s. Written by %s. %s %s Report bugs to <%s>. memory exhausted%#.0f%+d(NULL)helpversionliteralshellshell-alwayscc-maybeescapeclocale7.4?A=@??$"##&#6#F#V#f#v#########$$&$6$F$V$f$v$$$$$$$$$%%&%6%F%V%f%v%%%%%  M M l u  `` ```oU?oohx!8!o`o``X%5?ld 8! x! " % <PX$   !"#$%&'()*+$ܩ* -@U `gs~   & $8' )4>)Ie@Dt, HL. `( 0%-8AGNV(n>2  ?, L?" HQ '6@Q^P1 q{P  <)v AJ U#Z'c `;# p<& Є DJ X&~ `JD <,+' P$"` 6#dPE L ԩ>$ 0L) 9  F dp/  wI- ܡ%"P1 $X1$<> K% ةT #J ,J .4P] A`#IM  = $Q]b M^ ;%q 0$̩P%D<# @$J? %o+  $p#T-k =E 5lN  J#O#$T+  2#X#]ܩbT+` x*j l$s%zN+ O " p%ЩI. #\I %  %& ,L= С$!%p^ 0 0K >;! I4Om V$\_$e%l*F 4= A|G {< p;b   ءe %# !I   @% `G  F / X6 - D $K $T _ $l 0%t h<& / L% W# $ |I NZ  J h O `$  ! ԡ. #9 pFG J p$I L' Q + ^ I g = o lL$ w P> l>\ `%basenamefsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummybasename.cversion.cprogname.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1exitfail.cgetopt.cexchangegetopt_datagetopt1.chard-locale.clong-options.cparse_long_optionsquote.cquotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsstripslash.cvfprintf.cxmalloc.cfseterr.cversion-etc.cversion-etc-fsf.cxalloc-die.cxstrndup.cclose-stream.cmbrtowc.cinternal_state.0vasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cwide_null_string.0printf-parse.c__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START_bindtextdomainquotearg_colon_mem_exitusagerpl_getopt_long_getopt_long_rprintf_fetchargsquotearg_style_mem__fsrquotearg_char_memset_program_namebase_lenstrncmpatexitquoting_style_valsrpl_strndupxcallocerror_one_per_lineset_quoting_flagsxreallocprintf_parse__1cG__CrunMdo_exit_code6F_v__getopt_internal_rquotearg_n_styleexit_failure_get_exit_frame_monitorvasnprintfquoting_style_args_GLOBAL_OFFSET_TABLE_get_quoting_stylexmallocerror_print_prognamequotearg_colonquotearg_styleerrnoprintf_frexpgettextfseterrrpl_optopt__iobversion_etc_va__register_frame_info_basesstrcmperror_message_countsprintfrpl_getopt_long_onlygetenv_edata_environstrip_trailing_slashes__fpending_finimbsinitrpl_vfprintferrorclone_quoting_optionsversion_etcquotearg_freestrrchrfputs_endbase_namefwritewctomb___Argvxalloc_diexstrndup_PROCEDURE_LINKAGE_TABLE_wcslenrpl_optargquotearg_n_style_mem__fpstartquotearg_n_startfclose_mcountx2realloc__longdouble_usedmemsetrpl_isnanlprintf_frexplrpl_getoptclose_stream_DYNAMICabortmemcpylast_componenthard_locale_getopt_internal_Jv_RegisterClasses__ctypeVersionrpl_wcrtombldexp__environ_locksetlocalequotearg_mem__fsr_init_valuestrnlenquotearg_allocquotearg_alloc_mem_etexterror_at_linefflushiswprintrpl_opterr__flsbufrpl_mbrtowc_getopt_long_only_rversion_etc_copyrightxmemdupstrerror_rquotearg_n_mememit_bug_reporting_address_initquotearg_charstrchr__deregister_frame_info_bases_lib_version__dso_handlerpl_optindquotearg_bufferxstrdupclose_stdoutquoteargquote_nxzallocset_quoting_styleset_char_quoting@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > $ >  I: ; I : ;  : ; I8  : ; I 8 &I .? : ; ' @ : ; I 1 .: ;' .? : ; ' I@ 4: ; I 111  U41 .: ; ' : ; I4: ; II!I/ 4: ; I? < 5I% 4: ; I?   I&I$ > % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > : ; I8 &I .? : ; ' @ : ; I 4: ; I 4: ; I  4: ; I' II!I/ 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < v*''2intSfNfs\aO u*J*8%#9J#;J#^%p/p;UL[%Q[ Q[[\d\w]%]% d]$_%p//VHxrlpVh%d%`%\%XcOSrhrVpS H!%D"%@#%$% P &!L%!Q!Q!%"d>%p;;UL;%Q; Q;[<d<w=%=% ?%PX%;;ULW%QW QW  r#$A;%n&FrЩ&tU%&Z%&`%d`@<;intSfNfs\aO uq[#x%##val%# O% U   (!t%%#&%#'%#(r# -%#5r#W#[%# d%# e%#$ *%;<U L(% Q( ( ) ')r q13%<B<U L0% Q0 0 1 '1 d2q lA%D<g<U L>% Q> ? @ '@@J%h<<U LG% QG G H 'H dIqr4=<T+SintfNfs\a ub%<4=Un$9Vw&Wp'P <'=g2%S +;=4=|+06U%*S *8 #9#;#<# =# ? # @  # A  # B  #  C  # D  # intsfNSf\a6 uq[#x ## val #  6  \34==U L,  Q-\ . / 0 1n c4 P5 S==F=Xn bH5;ntt  5 l!   ) ==intfSpp==Un%[p v{ &p==U[%p-  b J=intP7fGIS!$8Si~Nfs\a u( ,# % .7W( 1P# 4%# 8W# g7  r s,#valt#^=9>Uo]e_%Sp` iP<>P>Toh,qP>l>TopspPP |%l>>To{Rc{i{%Suc}Qp~V%Qr%P%>>ToQi%Rr%P ! >?TPRo JJ ?L?U<JSsPVBJPPNN,L?nFUp@w,argJ, P%Ni,len,SJ,YYY1BrDmD!AAcescPm,'Y^@@1,R06HXw>D>,W)rBBj,R8EEDJVYJWT7gF,pFFU pC wC,R!argDJ D,!oEpGQeH%SrI,P _`F^GU!arg^J ^, ^!o_paWeb%pd%lre,S"bufg#GG$,%z&n, S`G{GU!argQJ Q, !oR';|GHUsv;Vi7Sg(9HYIU!n%V!argJp ,  e%l"n07sv;Sn1,hYgHp ret],P>|P{PdP ?0fintSNfs\aZ u} }dPPUsVn% len%Snew}P ZRP +06U%intPZfGlS6sNf\a HZu  (  ,#H . cl 2           % 1 A K  Z  f  w       X&   ` ay b( c1 dH7 eZ> flH gS ia jp lx m noH q s u w x y z { }r z 6aHl/ ]#a#& _ w O#arg_#//:,9 9-# C.# /H# K0# W1# a2O# q3# 4# 5O# 66#$ g7O#(9p_C w >O#dir?_# @O# AO# CZ B6PPU h6sPUs'  S=deXaey/]dU?X#UMNwD(VObufsxgsxcpViOxdp_xsxvOx0Ox*QUQQv*Q3Q*Q3Q*Q3QHP >QJQP!JQUQRhn*Ox+OQQ!QQP-OF-sS wHwHwOwHwfbpsWZwxhargHPSS!SS"6OF6sS T&T"9THT!9THT"COUU!UUPHOFHsV VVOw MHNHxOOxPHxQOx. argYHP J hWWargyHPb Rarg2 x3 x4 OSw< Ox 8C bufJ ~w K HP  OV8 / FXNX"  OF sVy XX0"XX!XX"!,Y~Ybuf ~w  HSHn5 OW YY!YY"p6 OF6 sSL ZZ"'Z6Z!'Z6Z"9  F wH HwI HwJ OwK HL OW,M OR N +ytmpO swP swpQ sShw OS S O[a[nsOS m q[[nOS <[\N] 1]I]!1]I]"# OFsS q]w]"]]!]]"Y w Hxt HQOVh  L xM HxN HxO OxP HxQ OW,R OR S +ytmpT swU swpV sS" arg^ HP >_ _arg~ HPV0  R@_L_!@_L_P\_s_!\_s_PH arg[ \!__]  pad ORend sV!;`X`q sQ w  OS #n Og``!``"(  OF sW aa O1X )j H aa$l %.l %5l _ml w ; HxD ] M HPYYqcck\!ucyc"vq argY HP &dGdargy HPOd[d!Od[dPkdd!kddP arg\!dd;X padORendsVx #nOyoe~e!oe~e" OFsW XffR\ffQ P fgo RffQ PKg4gQ Pc argRP #nOg,hRgh!ghPx OFsS hiargyRS arg RST7 argMZRT arglRS pj jargGHR  jsQPPh; HxD ] \q ORM HPM HP0u^uQP muujRouuQP 8 @buf ~w  HWq.vEv!.vEv"h% OF% sVmvsv"vv!vv"8#wOpadOW4Vxdx!VxdxP#nOxxxQxxxxxxxxx!xxxP!xxP OFsS8#rppsQendswswP`arg ] j{){qsQ u||qsQ?) Hg w ||_cw x ||m x $||$  %. %5 p_m y!;}T}mxUqsR oĀq sR !_OV!BbF<sPO&rNO'xMO'~MO'MO'MO&9O'x8O'~8O(sum:O+6?<6)*Y*H+x)*H+x, &XO'xWO'~WO&DO'xCO'~CO'COs- :H@eMintP7fGISsNf\aP (,#% e.u 0,MU sS wc> ps0P  ret+%P:%?P intz r ffB:PUxA:[AP;C,|,uo intz r ffBaB%oTxA%\AP;C,SgDVW ł _cwFV ʂ؂mFV C  X%Y iZ,Q I*a%]1b%[ _mV *|%[1}%] ,%H?z΄p8fSfint` D/D`6Dg w%3ADA OH:p΄T xG` PQR mSw ;T%P!\ЄZintP7fGISu[asNUPf\a  cIK2           % 1 A K Z f w       X \   `\  ah b ( c 1 d% 7 e7 > fI H g S io a j p lc x mj n o% q sq u| w x y z { }ur z w a >\%Io  ]K#aV#&  w ,#arg#/o%%ЄT$vVa$oUi&,Wap'ShpP u: yintP7fGISsNf\a  cI/2           % 1 A K Z f w       X@   `@  aW bl ( cs 1 d% 7 e7 > fI H g S i^ a jz p lG x mN n o% q sU u` w xk yq zw {} }ur z  [ P f > @ l % I ^  ]/#a:#&  w ,#arg# / ,9 9-U# C.U# /%# K0U# W1U# a2,# q3U# 4U# 5,# 6P#$ g7,#(9 C w >,#dir?# @,# A,# CR%U QUdQ aQcpSUST,pU,ltV,hW,dX,`/jV]?e618cP_`g,XdpWonpUVn,TRPM,Pz G/HK%V L:,PnpUV(n,@,PFP̈̈PXnpUVUp n6,6,PF6Pn,PԊRNJԊPn7,V7,PF7PkwkwP%#@,PFAP!RP̎6n ,L R P  "9,#x8,#~8,sum:,$:%4 /usr/include/iso/usr/include../libbasename.csystem.hstdio_iso.hstdio_tag.hstdio_impl.hgetopt.herrno.hversion.hexitfail.hprogname.h'+GHH{9k:)fi{)'=V#s*uY 8:]yOKV# version.cE progname.cx*" w+ 9: c? /usr/include/isobasename.cstddef_iso.h* L(.I,y+sSX( U;GK t+WGU:h40:ŀmdqƚp9 /usr/include/usr/include/isocloseout.cerrno.hstdio_iso.hstdio_tag.hstdio_impl.hexitfail.h+*%d# &;yG) /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/includeerror.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.ht,c+U+Xdvsr* +#c9#  c +8:48:G R.(+f0d cɸ+Z*:%N$ exitfail.cA /usr/include/iso/usr/includegetopt.cgetopt_int.hgetopt.hstdio_iso.hstdio_tag.hstdio_impl.h.qdb9+:`\HF,(:6.:53GqIH8,*:`!5kŎVTf;Esc@s99Gcʅ~99q[dW;e7eM T-Uz@s,0z  2z9rrrtI UZiq!r9z+zUUzUG+hV dW2U-y8:8:<*+<({H8H*;qU}x G9~UU0x2:8rU~U y9rrru<.+&$I]mq'c#9rV|qǎ~U}8::'FU:/79I+~'U~8:~d8:8::c*G:T}(+~e}x58::~2&q$|3&}0q,+yV**i`X6VX: Gd_9 getopt1.cgetopt.hgetopt_int.h;)d?d Gd?dM! hard-locale.c<$);eRX +T,0N.F,: /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/include.long-options.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.hgetopt.h4=2G Bh+ge+ 8::y 5 quote.c=d1d; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.h=rdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnG /usr/include/isostrndup.cstring_iso.hdPVb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.hP cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHFqCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.hЄ$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.hy9:trsdrT:grq|qX lP>,ll>\ X l>$0l>2 @,l ?, .<lL?" .. H.,lpFG &. <lF 9. .. $l`G .,l|G .LlHQ V.w.  ... #.$l\I .$l|I .$lI .$lI  .,lI- .,lI. .$l,J  .$lDJ .8l`JD . .$lJ  .$lJ .$lJ  .| , J? .| 0 0K  !.| 4\ K% ..4\ L) ..4\ ,L= '. .,\ lL$ .,\ L  ..,\ L% .,\ L' .|  M | ` M^ C. . ...7. ..$ lN  . H NZ  ......| , N+ ..| ,,O  ..| ,p4Om .| 0O .| ,dPE  .| $@P1 .@P1  .V .../.. ..0A......6.o.;..2......| ,He .| $P]  .| 8  | ,p^ A| L\Є l | 0  *.![usagemainJ%Version4,set_program_name|program_name<4Elast_componentbase_lenbase_name`1Jclose_stdout_set_file_namezclose_stdout_set_ignore_EPIPEclose_stdoutry(errorverror_at_lineerror_print_progname)error_message_count;error_one_per_lineb exit_failure  _getopt_internal_r&_getopt_internalrpl_getopt,rpl_optarg>rpl_optindPrpl_opterrbrpl_optoptfDrpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_rhard_locale%parse_long_options$:quote_nquote51 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals)f%:strip_trailing_slashes&Erpl_vfprintfeH(gxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdup*yNfseterrP(,|version_etc_va version_etcfemit_bug_reporting_address(.version_etc_copyright/xalloc_die(0Exstrndup0Nclose_stream~2rpl_mbrtowc4rpl_strndup4vasnprintfQDrpl_wcrtomb&SVprintf_frexp Shprintf_frexpl\Urpl_isnanl##V printf_fetchargsYprintf_parse'x*j*+t,  .u ;<4==-5= f%J?&0KH(K'*M (, M/N+(0O04Om~2O4dPE4P91Qe&SP]S\Up^#VЄY Al`t:u; k  4 q  l k {+uk ; 4   q l k 8{+0Huk ; Z   q ^ l . R #k qv+064 o ~Y ~`c@ ` e T [ _|^|*^8U~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O(xT #0~T #0< m0#< mX#1u 5< AuFy0/"0GNU C 3.4.3 (csl-sol210-3_4-20050802)basename.c/opt/pkgs/coreutils-7.4/srclong long intlong long unsigned intunsigned chara_charshort intshort unsigned intlong double__FILE_cntpad_ptr_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerusagestatusemit_bug_reporting_addressmainargcargvbase_nameremove_suffix__iobrpl_optindsaved_errnoVersionexit_failureset_program_nameversion.cprogname.c/opt/pkgs/coreutils-7.4/libargv0had_slashsize_tlast_componentsaw_slash_Boolbase_lenprefix_lentmp_lengthcloseout.cclose_stdout_set_file_namefileclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.c__gnuc_va_listerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineexitfail.cgetopt.coptionhas_argREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optoptrpl_optarg__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptexchangebottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlyprint_errorsnameendpfoundexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalresultrpl_getoptgetopt1.crpl_getopt_longparse_long_optionsopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardlong-options.ccommand_namepackageconversionusage_funcsaved_opterrn_authorsquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsset_quoting_flagsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledquotearg_bufferbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimmbstatebytesleftversion_etc_copyrightquotearg_alloc_membufsizexcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_vals__ctypedefault_quoting_optionsslot0nslotsslotvec0stripslash.cstrip_trailing_slashesbase_limvfprintf.crpl_vfprintfformatoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupa_stringfseterr.cfseterrversion-etc.cversion_etc_vaclose_streamtmp_authorsversion_etcversion-etc-fsf.cxalloc-die.cxalloc_diexstrndup.cxstrndupclose-stream.csome_pendingprev_failfclose_failmbrtowc.crpl_mbrtowcinternal_stateretcountrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_floata_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerargumentargumentsdir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memoryoverflowbuf_neededlengthbuf_malloceda_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharactersremainingtmpbufmaxlen__x_ntmp_memsizesign_value_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.4.rodata.str1.1.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo1'  /"llu 7oEodd0Roc 8!8!@o Bx!x!h s""x%%i~ 22 <<PPXX$$X|      P!~' h /8FaR#B&#^LekTw{PЂ0 b0707011d719ca5000081ed0000000000000000000000014a5bb2cb000271300000012e00000002ffffffffffffffff0000001700000000root/opt/aosug/bin/catELF.4Pj4 (,+44o(X/usr/lib/ld.so.1  "#$%'*+-./12356789;=?@BCFIJKLMOPQTWXYZ]^abcdehiklnqstuvwxyz|~ !&(),04:<>ADEGHNRSUV[\_`fgjmopr{} )/ ?40 KQ,2V _iv`>   T (1V :DR\gg2 Lg, xg" 4pQ  $-z H {  epf1 t $t) - ;|+EYr o.v<-|*- <+d! s n QZ -H UWVS E 0ƅƅƅƅƅƅhƅXƅHƅ8 ^_h5jY[hqhg$g$S jh hu u0 tYb7AET jh hu uƅ80 uXRjPhXQP=Dž4wB=4?p%=IƅM9}M ޿~ƅXP5PhXRQ=Dž0wB=00t9XX ЊH Ȋ8 Њh Ȩ490 DP0?\1҉މ,)PWV5|=tRPSVj9tσ h\ P5jPWV5*=u5h5jl1, 5 5~5h5jƅkst[etnƅwvuk|vuvƅHXƅ8vƅƅ9ƅh,ƅHƅXkƅX ƅX=})=~` jTp%=Dž4XhlDž0Mhl13 L?5hG PjjSxY0 Po<04D$H<\1)Ӊ$ \ 1)Ӌ 4 Aމ9wlP4Wj;4t! h% P5jh4)94vVSWދ 9a+R0 592 Љ B< x aHtNv ~w_FAÀw tm t)^C@FԈBFÀ tU uDžvt\MFV-v:Cur^B?x8u f8t^FI낍Cr^BD^F?7~[~'hDžtAu"t5V8ƃXt$F Fo5V8ƃQSj=9t! h P5j h P5j5h5jƅ5UM96u 1P jyڃ h P5j#뷉5h5j+uM 1$ b+uNPSj9t h) P5jlwPSjy9t h P5j0vRjh hhB P5hch(hHjB jUWVS ]1ۋu t"vPSVu5t t)ue[^_UWVSj/]S]t@EE)؃~0u,u]4uve[^_UWVSDjR ƅ>bVVG B=1}uU; ƅ ]XEEv}u=}T EEEC}t Mąhu NjUU; EUu; s B1ы D1tt4 ?t F> e[^_Àpt# tUEtƅ E1}E󫋅81EƅCƅ4v4uR8 Dž<Dƅ@ƅ4@tDm}u@}jU EEEC}t EąEE<8Eƅ41D1 v PƅVPP8Z P8,P}#Dž<88Ds Vƅ@ƅ URuhhh8hBERPs  Ps C,P"g'C$C 8"C, C(4IADž<ƅ@ EPuhhh8hBEsVPPs  Ps C,P!C$C 8{,` C(Vkc[C$C(h<8C$8Dž<1I+C$C(C,hhhhkhhhhkUWVS EuEEEM }1ۍV Cu  WuQhus hhN Ph uMXZuhx.$V w$ uhDE EEe[^_" uhփ uhɃ uh뼃 uh믃 uh8뢃 uh\땃 uh눃 uhx uhhWuhunUEPuuu u Uh6h$7 hghch|$XZhh$Uh PhjPUuuuu u6E xÐ= uUu uFtÉ= uvU uu u\GtÍv= uFSD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$VxGe[^ÉP</ZtPSUGe[^Ív@PSD$ ÉD$ÉUh8Gta=t = tO h tM P RPh5j" P} hFuÉPh5jUWVSu uh,u?H  huue[^_ÉRhSVt hƒPRhhHyvhj ]w W\UhtЃEPuU EQ5h0hnEPuU EÐUVSu]t95t\5 htSVS5tjPh[^EPuU EGe[^Ð9tSPtP5h=hVS5u3UWVS T$ƋB D$D$D$R$9Љ$D$D$~\D$9‰~RT$,$+$+l$9T$~`19}'D$)D$ L$T$ G9|)l$$9D$YD$+$D$T$B D$B$ [^_]Ív1L$$G;|$|T$$T$9D$~T$9JUWVSlE$@EU::rUҸQM$A FE$X$X u@E }$1ۅDU$ZM<-X<+ 1U$BM$uA}$}t ?XE$U$@$9؉E~]Z$M$A 9~؉Y }$;]U 4u7U}$9W C9tE }E$U}x$;]H} :-M$yt CQ e[^_ÐAE$X$X u@E 1ۅ hAU$ZM<-FBBiu1Ʌt<-u| E$x}]5U$M B<-tMz}EEEE}t<=t EUuuEM+MMԍvPuu6u>>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PuEM$@A}VuuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7WhQ"ZYPh%U$?r뵋Et)M x-t}PuEtBU x-+ U$rPM 1ShZYPh }$E$U$@5C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Shk}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2Ph^_PhUȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1Qh4_ZPh}$ }1}ыELU$JMA B?C}]ȉ}EE t0ShdjZYPhmU$RUCVE 0Sh;ZYPh>cut$E t0Shd ZYPhM$Q׊EэLE$HU::M 41ShZYPh}$GE!VE 0ShZYPhN]M$Q1ыE$LH?}71Wh3[^Ph6E$@ESuuTE$P1ыE$LH?}7E 0Qh_ZPhMM$} 47ShZYPhUh u uuuuu u $ ,( ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuVtw PtehVtSP_t(hVZtSP9u1SV4$|e[^_UWVS u ]}tmtb Wu;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]su貽USPMɋU t1 APq1uuE ]Ív`ȐUWVS}MWɉEUtk GPu7u 1҉Eu1MÃCSEZZuu7u uډ&EU tUEe[^_ÐU덿`nUuju uBÐUVS;5s tC;rF=t Pt V蹻e[^ÍvUWVSƅUE#95wyVEUE}PP$}ãtS=M)1<E裼E UP|PRE؋E 0uUuUi 9EwI@Et W蝺 uW_Duu܋U 2uuU E죈e[^_É1̺vUh`EU jÍvUh`uEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<}` EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUWVS }u ]PSVWy-tuvPSVWƹxӍe[^_UWVS }u ]PSVW觹y-tuvPSVWzxӍe[^_L$T$ABuAUWVSuu PP}Dž(ƋtRWSjP9rۉx1e[^_Í9t VgO W|US]S踸t]ÅtvUS ] Su蝸t]ÐtovUSR]M ۋtsB‰U ]X[u@/vUS]S\ SjP8]Uu u/tUS] S SuP3]ÍvUW U1QR}VSt$ \$19t2Bw Bw ɈtFC8t)[^D$H UWVSj1yd=$?1<$$$ы$LQ$ytJ$dµt$8*uxu$$dvd9u Dždde[^_Džd5" h轵G8>1йѻ ߹ы I1KXt |/tfX; DPε`4RSVPt `/XB`QRhPXZh`õDžPDžLHF@FA tۃ tփ tу#u=F@F tHy߃ VPƒپVREhWEPhV<H1}IHh򮋅LхyPHP PLZPPt>PL)EP+HP豴Y_hRKS衴DžLt Sb V膴Lҿ5tPL9ϋ`t `= VƒP5HLHPPLiUWVS E1I?ӉM=&)čD$H1;}As%D; +8uB)ЉG;}rۋE}}1t# E)Ƅt83t.uEGu QSe[^_Íe[^1_FG;uuӋEUσ PRB}]txEEEE}t EąEȋu9F0EBEBtEĉB EE(Ece[^1_à }W譯tEEPRPu PEu,Ptlt|usEE8EąT EEP;Ehhh8hB`EEE릋]E1щHEE P/PUЃ߉tftDž(@<19(B8(@78|t+D 9A tK<+uO8;Luˋ7$9ɉuC()؋(<(@(9(I}DE}1DžE󫋅DhLEƅHEƅddu`H*hDžltƅpƅdpttF8|:t9D: (<4)}uB}]EEEE}t EąEENE딋l89\Jh49ۉ.@9hƅdAEM 8Me[^_É }W4uhhh8hB$EPPu PEu,PEE8Eą E薪E}uB}]MEEEE}t ]ąElEhEƅd LP ƅHLRQPh PHh,Py~Džlh8bt3 LƅpPVƅH}EE9EUE1HEE }Wuhhh8hBEWPu PEu,P.EE8uą EVEhlDžlƅpSlhDžl1Hlhhh8hBاhhh8hk跧Eăhhh8hY萧EE,EUE1HEEhhh8hY0hhh8hk}hhh8hYhhh8hkͦ_hhh8hk謦!hhh8hY苦 v(@(<(9(<XUWVS< E uE1E}E$]EEE}EtMąɋEE h1LDž8ƅCDž<Dž4ƅHEы8ƅdƅƅu`  Dž$ƅ ƅ t$C< <;8H8+4LDžltƅpƅdpttlhƅdNduĀHuGht LWɣ ƅHPPh PHh,P- E 2 Džlh8 t ƅp+ƅHE EU ƅDž1DžE DžMtm vd9w\ +PZ8u Džۉ MGU:rtuY1e[^_ÉU tG8uABuEe[^_à V} EuVWPu PEu,P  ` EE8 ]ąE hhh8hYe$ 8d4uTH; h Džltƅpƅdptt <8t8}t2E9$t\؉E;]tӋE9ۉ։ljuSjHPRM x1\ƅXƅXƅtxDž|ƅƅtt x|XЃxƅtv|9x|v؉ƅxƅttuZXk$Dž|ƅƅttu`hDžƅƅt8w|9u-x9Ɖ׋v \PQƅXPPx PXx,P@$Z?Dž|x8b3 ƅ賜DƅX8 P荜ƅPPY P,P|tzDž8 ƅƅDž|ƅbDžƅ|땋xDž|1ҍB|렋Dž1ҍB닃 P8_ƅRRP P,P& Dž8$hhh8hY襚hhh8hB脚&hhh8hBcDžlƅplhDžl1ҍBlhhh8hB Džƅ  ƅ P謙ƅhhh8hY茙hhh8hkk}hhh8hYJ*hhh8hk) \WƅXXSQPxʷ PXx,PPJDž|x8]p ƅSeƅXDž1ҍBLhhh8hkChhh8hBEEhhh8hBŗe[^_hhh8hY薗>hhh8hkuDž|ƅ TPU E&ƅCO| LW=ƅHHSPPhɵ PHh,PpDžlh8ttvhhh8hYoXxDž|1ҍB|E EVQEHl ƅpSƅHhhh8hkҕA PPM QE~0ƅUC]E1щHEEhhh8hBTbDžlƅp0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt Ju0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 -3F<vF<w Dž:\O AOu\8ml<$۽ ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @eLt Le ue|1XDE |nKI;w0CJu + g 1ۃ؃w ICNCFC? E 21 EEEsEEc E %E EF9sE_;UlURU> PQ PP uPEEG E.EE E P+QEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt PN AURU P_NUVS[:p@Ћu[^US[oR[US[Q[bns"v3E=TGAP~U}mbuiter_multi_nextmbiter_multi_nextQQQQ~QqQdQWQJQ=QCopyright %s %d Free Software Foundation, Inc.]ekxzglm4mLmgdmdmblThThThThThThl^llllZl General help using GNU software: Report %s translation bugs to License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous bug-coreutils@gnu.org Report %s bugs to %s GNU coreutils/opt/aosug/share/localebenstuvAET--write error%s: %s%s: input file is output filestandard outputclosing standard inputRichard M. StallmanTorbjörn GranlundTorbjorn Granlundcat/.libs/lt-mbuiter.hmbsinit (&iter->state)iter->cur.wc == 0*iter->cur.ptr == '\0'%s (%s)UTF-8mbiter.h%s (%s) %s (C)Written by %s, %s, and %s. Written by %s and %s. Written by %s. %s %s Report bugs to <%s>. memory exhaustedUnknown system error%s: %s:%d: %s:POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous CPOSIX"`ASCIICHARSETALIASDIRcharset.aliasnumber/opt/aosug/lib%50s %50s%#.0f%+d(NULL)number-nonblanksqueeze-blankshow-nonprintingshow-endsshow-tabsshow-allhelpversionliteralshellshell-alwayscc-maybeescapeclocale7.4?A=@??****++"+2+B+R+b+r+++++++++,,",2,B,R,b,r,,,,,,,,,--"-2-B-R-b-r---------..".2.B.R.b.r.....  U U  }   ` ```t&`oo\$o(l(@o`o``. 0 ?  \$$t& l( ( * . 5( !"#$%&'()*+w} L(P;TPX [bn(y/ 40 $*9BL[h,2V v `>   +7B^ yT V  (H"+18@`(Xg2 sLg, xg" 4pQ  %.z I {  ,fqg1 (&3@NZt pt)  |+r .<-*- <+ d! %0s 7n JQZ e-lHt+M /c|.jp\+MS  v,}$K, =j ,<,(f\ .l-\-,,cb v   R* ^ Xr S '= P Yd& m-vl++c* s |  \.(u$ Lu Q  0  q ,  - + q- . \^ 9 ."Q In b q q w $ d ,+ pd# (! . - + . L.  xsY rD  v  0L-& ; H S U i Uk o <.| З  uG * lu% XS' S` B+ TR+   T/~ ,1 \,  | !T. l, |,',t%  -& =M 1 q : Hd& I Z ` !,-m xP^ | nG P o pr k PK% W  s    $d# + ,  , , t=  E & fE < |-C hf U H2  s ,| { R2 U r  + L+ q  o @m / R. - , `e  ,. -catfsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummycat.cline_num_printline_bufnewlines2line_num_startline_num_endnext_line_numlong_options.0infileinput_descversion.cfull-write.cprogname.cpropername.c__func__.0mbsstr_trimmed_wordboundedstrnlen1.ctrim.cversion-etc.cversion-etc-fsf.cxalloc-die.cxstriconv.cbasename.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1exitfail.cgetopt.cexchangegetopt_datagetopt1.chard-locale.cmbrtowc.cinternal_state.0quotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionssafe-read.csafe-write.cstpcpy.cvfprintf.cxmalloc.cc-strcasecmp.cfseterr.clocalcharset.ccharset_aliasesmbchar.cmbsstr.cknuth_morris_pratt_unibyteknuth_morris_pratt_multibytexstrndup.cclose-stream.cvasnprintf.cdecimal_point_charwcrtomb.cmalloca.cmmalloca_resultsmbslen.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cwide_null_string.0printf-parse.c__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START__initxreallocprintf_frexplsetlocaleerror_message_countquotearg_colonprintf_frexpfwriteatexitxcallocxstr_cd_iconvrpl_vfprintfrpl_getoptexit_failurerpl_optoptstpcpyquotearg_alloc_mememit_bug_reporting_addressungetc___Argvproper_namestrerror_rset_quoting_styleiswprintlast_componentwcslenset_quoting_flagsquotearg_freerpl_wcrtombfscanf_exitquotearg_n_style_mem__longdouble_usedsafe_readxstrdupabort__fpstartbindtextdomainversion_etc_copyrightwctomb__iobfputsstrchrstrnlen1set_program_nameiswalnum__assert_c99_environset_char_quotingxstr_iconvxmalloc_finimbsinit_getopt_internalfseterr__ctypefreeaquotearg_stylemmalloca_GLOBAL_OFFSET_TABLE___register_frame_info_bases_getopt_long_only_r__filbufgetpagesizememcpy_PROCEDURE_LINKAGE_TABLE_quotearg_colon_memprintf_parsevasnprintfxzallocversion_etcusagembsstrquotearg_memgetenvrpl_optindfclosefstat64quotearg_n_stylerpl_isnanl_get_exit_frame_monitorproper_name_utf8quotearg_n_memerrnoquoting_style_argshard_localegettextrpl_getopt_long_onlyldexpnl_langinfofopen64strnlen__fpendingrpl_opterrsafe_writequotearg_char_memlocale_charset__environ_lockerror_print_progname_lib_versionclose_stdout_Jv_RegisterClasseserroriconv_closexmem_cd_iconvprintf_fetchargsc_strcasecmpxmemdupbase_lenbase_namexalloc_dieVersionerror_one_per_line__fsrsprintfxstrndup__dso_handlestrcmpmemchrrpl_mbrtowcfull_writequotearg_getopt_long_r__fsr_init_valuequoting_style_valsversion_etc_vaquotearg_buffermbslenquotearg_style_memtrim2_getopt_internal_rrpl_optargis_basic_tablerpl_getopt_longmemmovestrrchr_etext__flsbuffflushx2reallocrpl_strndupclone_quoting_optionsmemsetget_quoting_style__deregister_frame_info_basesiswspace_DYNAMICerror_at_linequotearg_char__1cG__CrunMdo_exit_code6F_v_quotearg_n_edataquotearg_allocclose_stream_mcountstrcpystrncmpiconv_open@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  : ;I I !I/ : ; I8 &I : ;I8 .? : ; ' @ : ; I 1.: ;' .: ; ' @ 4: ; I .? : ;' I@ : ;I 4: ;I4: ;I 4: ;I  : ;11 11 U!41"41 # U$ % &.: ;' I ': ;I(.: ; ' I ): ; I*: ; I+4: ; I, -4: ; I.: ;I/4: ;I0&1.: ; ' I 2 3.: ; ' 44: ; I? < 55I% 4: ; I?   I&I$ > % $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I U  I & &I4: ; I? < % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % $ > $ > : ; I I : ;  : ; I8 I !I/ : ; I8 &I .: ; ' I@ : ; I : ; I 4: ; I  U U11 11 4: ; I1.: ; ' : ; I : ; 4I4 .: ;' I : ;I.? : ; ' I@ 4: ; I !4: ;I "!#4: ; I? < $4: ;I? < % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I  I &I% : ; I$ > $ >  I : ;  : ; I8 I !I/ : ; I8 &I .? : ; ' I@ : ; I 4: ; I  U11 U 11  4: ; I .: ; ' : ; I : ; 4I4 .: ;' I : ;I!4: ; I? < 4: ;I? < % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ >  I< .? : ; ' I@ : ; I : ; I 4: ; I &I 4: ; I? < % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > : ; I$ >  : ;I.? : ; ' I@ : ; I : ; I  4: ; I 4: ; I? < % $ > : ; I$ > : ;I.? : ; ' I@ : ; I : ; I  4: ; I  I & 4: ; I? < % $ > .? : ; ' I@ : ; I : ; I 4: ; I  I&I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > $ > .? : ; ' I@ : ; I 4: ; I  4: ; I   I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > : ; I$ >  : ;  : ; I8  : ; I 8  I .? : ;' I@ 4: ;I 1 41 U  &I.: ; ' I 4: ; I 4: ; I I!I/ 4: ; I 5I% $ > $ > I!I/ &I4: ; I?  % : ; I$ > $ >  I : ;  : ; I8 I !I/ : ; I8 &I .: ; ' I@ : ; I 4: ; I 4: ; I  U U4: ; I11 111 4: ; I.: ; ' : ; I : ; 4I4 .: ;' I : ;I.: ;' : ;I!.? : ; ' I@ "4: ;I #4: ;I$!%4: ; I? < &4: ;I? < % $ > : ; I$ >  I< .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I : ;  U : ;  : ; I : ; I4: ; I  U&II!I/.? : ;' I@ : ;I : ;I 4: ;I 4: ;I  4: ; I? < % $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I  4: ; I 4: ; I .? : ; ' @  U UI!I/% : ; I$ > $ >  : ;  : ; I8 I!I/ : ; I8  I &I .? : ; ' I@ : ; I  U4: ; I 11 11 .: ; ' : ; I : ; 4I4 .: ;' I : ;I!4: ; I? < 4: ;I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < =0'-KP *7P *W 8#_ 9#d ;#j <# p =# w ?#  @ #  A #  B #  C #  D # intKc  D)EO6el% >aDVM3W  css jx p{ vs |s 3;<#=3#S :3 :##k# val# %###### #$#( #,(#4#<"#D*#L2 #T= #XG #`Q*#p 3 : 3 : % :YS0)2U_RS00fn),22T~R2=U W}~}~}ok}cP } }}}}~}}+|9|C|T |^!m# z;3 4}44}.d5n5$Fd5n5Xd !p"{S#N("/S$55!;R8l8 FR8l8Xd @!p"{SF{88Xd `!p"{S#$" S" |"" |"- V"8 P"C |%@8F9"T W"_ S#t!m { X9f9  " S{ <<  " S{ <<  " S~  : A&'sb(F)buf~*+,-n&P'ptrO.O/p0Q/p1R01{ cat*~**~**C*T***9*+-ch+~-eob~+~+2l /wp~,03 *~*+ , :;4 44 :4% 4-  54> K4R7 ? % :]=/ fF~uI~L~OF==-%7=BK==intP7<,==Ufd;%buf; ;,S=,W ptr>V B,P   K:%c^>=j:#=^>U"jS)je*jppuK >jr'"K`>Kintc:G^ %W (,#, e./)( ptr/#H#0:# wcS# bufA#5 %Q% e9BHnPo:#[p#aq:# curr# k\ {2:`>;IU 1/Vsub1/R3~4:~88/~P?@:~A:~xGQ~>3?TC+??=Qv:Spw/x:RV~@@8A+@@=QR APApB+A3A=QxwD{DG+DD=QdQ~'E+ElF+5ENE=Q }|3>&\&5 e HG5:c4%P/# bufA#5 eQe W Lef/#Pg:#[h#ai:# curj#$Q +*PKuPU s)/ how)7 d+V=Hi4KLhNKKQV8LLprR[D7SrEM_McN,MBMQ1ut3>Q5 W G5:c4e^733 01F ( RRxPCQ+06KXU%P*S P*W8 #_9#d;#j<# p=# w? # @  # A  # B  # C  # D  # intR[Hc  W  `+xPQU u(p |)Q )l *W *= ,9S PP 0=R.6 fQQU u |  =fQRRUHK;y  TRTRKint W O.% yd  RTRintK W !TRRU-%  SRintP7K SW  '"%RRUsrc  , , cd  3! ;!  C#%P S},jJ,}RRUsrc+cd+ n-}PX8}RSUsrc7 c7 p7 n9}P :%0b  SS{intP7!SVST e"Pp#Q$S K  p,XSSToRlenq,P r, KSSUJVeLSM,P- 4 TSKP*7P*W8#_9#d;#j<# p=# w?# @ # A # B # C # D # int W  o*SST M)oPu % OSST  N  lSTU (  poP:,;-  & $o  .u  VT0 Q+06KXU%P*S P*W8 #_9#d;#j<# p=# w? # @  # A  # B  # C  # D  # int 6W  8 TUU _ W C  V V  j =  UKU @R w6J j C i sko n(65v UUU _  C   V j =v UVU_ C   & S VV j =X"    7# :    ^H5; N >aX VV intK W -% <!dV intK OW P*JP*W8%#_9J#d;J#j%ccU;%;  ; < < =%N =% n?%P5 X%d!dUW%W  W  r#$A;%& Fr&U%& Z%& `% d @d$d@ intK OW #%#k#val%# O% U   (!%%# &%# '%# (r# ( -%#6 5r#A W#L [%#^ d%# m e%#$ J *%$dGdU (% ( r( m) Z )r qd 3%HdndU 0% 0 r0 m1 Z 1 d2q  A%pddU >% > r? m@ Z @s J%ddU G% G rG mH Z H dIq`ed +Kint W  %d`eU $9V &Wp'P dSe 2%S +95 f`e intP7GIK W (,#%e. p C,`e fU pwcBp sBvV nB,S psBW  OH  Y,l 8 wc\>p ret],P>|P- s f intP7GI !    4 J ` _ K W ( ,# % .7W{ ( 1P# 4%# 8W# g7   r s,#valt#u ^ fefUo]e_%Sp`  iPhf|fToh, q|ffTopspPP |%ffTo{Rc{i{%Suc}Qp~VS%Qr%P %fgToQi%Rr%P   gJgT PRo J JLgxgU JSsPV\JPPN ,xgnUA @H ,argJS ,  P % Ni,len,S[ Jh ,y Y Y Y 1 k rHl m>l !i iXcescPm, Yhi,RYHw>D,W)jjj,RdmmJVJWT78 F,nnU A C H C,R!argDJ S D,!oEpGQeH%SrI,P  `noU!arg^J S ^, ^!o_paWeb%p d%le,S"bufg#1o2o$,%&n, *SooU!argQJ S Q, !oR';9o1pUsv;Vi7Sg(9G4pqU!n%V!argJp S , r e%l"n07sv;Sn1,hZYgphq ,`valW %\ ,P#2q>q$pgqqU!n%P!argJRrqqU!n%P!argJR S ,qqU!argJ qqU!argJ S , o q%rU!n%!sPR!argJoH (rVrU!n%!sPR!argJ S ,oH XrprU!sP!argJ Q prrU!sP!argJ S , rrU!argJ S , !chPr   rrU!argJ!ch  rsU!argJJ ssU!argJ S , Z Z J)!# bufA#5 eQe W9BHnPo:#[p#aq:# curr# k\ f":z{U  /p  /S 3!fm#%l &lQ9i9%Wj9%RbE^Pjn%Vo/hp/W/% ): {U '/~ '/S 3(fm*%~"+ ,l~8/~7j8%PK{||{{Rg!|S| 8iO%~jO%SPb[Rxj%~~qHBR%V:R _ׁRQ }|3>\5 W G5:c4e? G O Q!WЗU / / @ ^*.h \8SR j:|r%|%|%|֡~ء}Ld 5R %Vȇh u.LR  "j2:{"r3%{"4%W"5%{"6/{#b:e "e/Q"f/RF =_ R: "}"|3:X <GeRlύ RO  R` n/|:P( "nV/|"W:P^$% j$ 0&1 I! ЗintP7K SW  '-.%ЗUsrc,- ,,, cd, 3-8 ;-> 0, n1}V W @ <,Sa??7buf?Dtmp?A_ A-_ B,_X F}_ G,_resH,P  -_ ,_ }_ ,_ res,P %S3S},USEK}PUsrc-Rcd̊ n}t ,x C%P h}RuY}P Usrc-Sc-Vp-W  n}P D cdVn}W`%S %S:%<"? intP7 ?Un, s P K  #@KP*7P*W8#_9#d;#j<# p=# w?# @ # A # B # C # D # intR[, W  o:@U u9V ; <S =P :#?0intK ZW }UsVn% len%Snew}P Z  $1!Q+06KXU%intPZGl6 W HZ  ( ,#H ..cl 2 5 ? J U ` l u             5 N e X&  `aybcdHeZflgijlmnIoH&qs2u@wJx`yvz{} 6aHl/ ]#a# _ O#arg_#/:,9 -# .# /H# 0# 1# 2O# 3# 4# '5O# 66#$ 7O#(;9p_C >O#dir?_# J@O# [AO# pCZ B6)Uh6s,1Us; Sj =deXaey]1XoND ObufsxsxcpViOxdp_xnsxOxOxvQvvvv@ P P!R` n*Ox+O$?!$?P -O8-sS w HwHw#Ow)HwfbpsW7ZwDx`argHP.D!.D"x6O86sSlr"!"CO!PHO8HsV MOw  MHNHx#OOxYPHx]QOx. argYHP J բargyHPb gRarg2 xn3 xv4 OSw< Ox [C bufJ ~K HP  OV[ / "  O8 sVy ޣ("!"!xʤbuf ~ HS@n5 OW 2!2"h6 O86 sSL Z`"s!s"9 F w H HwI Hw#J OwYK H]L OWM ORN +ytmpO sw\P swpQ sS`OS S nsOS m ϦnOS <\N] }!}"# O8sS è"֨!֨"Y HxHQOV`L x M HxN Hx#O OxYP Hx]Q OWR ORS +ytmpT sw\U swpV sS"arg^ HP >Olarg~ HPV(g R!P!P@arg[ \! ] pad ORend sV!q sQ OS#n Ogի!ի"  O8 sW ( O1Pj H (.$l %l %l _ml w Hx ] HPYYЮk\!Ů"vqargY HP rargy HP!Pί!ίParg\!;PpadORendsVp#nOyʰ!ʰ"O8sW gRֱQP Qgo RBQPK\QPcargRH#nOHxRH[!H[PpO8sS _argyRSarg RST7argMZRTarglRS pPlargGHR largAZR arg;HR>  \q OR( HPEHO$#FR!:FPhO8sS]arg ] w*d OH!$%%_mw[p @bufw ~x HP "ͻOVhn Ox`"0" O8 sVgm"!" H V $_cw x .+= x m=E$]  % % p_m ;y!R x Խq sQ ]gj R NQ0P (]g RfQHP` Hx ]>  \q OR HP HP|QP gjRQP[ 8buf ~ HWqz!z"`% O8% sV"!"8#wOpadOW4!P#nOQ!P!PO8sS0#rppsQendsw\swPXarg ] jSuqsQ qsQ? H w _cw x  x $'$  % % p_m y!xUqsR oq sR MmOV!8<sPO&NO'MO'MO'MO'MO& 9O'8O'8O(sum:O+6?<6)*Y*H+x)*%H+x, &9XO'WO'WO&>DO'CO'CO'COs- :H@=".4DintP7GIK PW (,#% e. 0N,4U sS wc> ps0P  ret+%P:%n">/NZintP7K ZW dBUnA,P mF,R  pJ}S  sN, IxkNTpjQ5 sw, ~xIS8 ~}R`L K W (,#7W.))( ptr)#%#04# wcE# buf;# / eKeWBHnPo4#[p#aq4# curr# kK %P;U )P!%V"+x68cuQH }|H3>^ K^/W NG54c4e^j 01 ;%0<W intK B:<UxA:[APC,|,%G1[W intK BaB%[TxA%\APC,SDVW  _cwFV FV CXY iZ,Q 5a%]b%[ _qzV |%[}%] ,%H?v&1\int` DD`DgW w%3DA H:\T xG` PQR mSw T%P'.2|(intP7GIQu[aKXUP W .cIK25?JU`lu     5NeX \  `\ ah b c d% e7 fI g io j lc mj n Io% &q sq 2u| @w Jx `y vz { } w a >\%Io  ]K#aV#  ,#arg#o^ %%|Tj $vVa$oUi&,Wap'Sp|6p( u6(R3r|GintP7GIK W .cI/25?JU`lu     5NeX@  `@ aW bl cs d% e7 fI g i^ jz lG mN n Io% &q sU 2u` @w Jxk `yq vzw {} }  [ P f > @ l % I ^  ]/#a:#  ,#arg#  ,9 -U# .U# /%# 0U# 1U# 2,# 3U# 4U# '5,# 6P#$ 7,#(;9 C >,#dir?# J@,# [A,# pCVR%|rUQUdQ aQcpSUScT,plU,lV,hJW,d[X,`jB ]o1e"1cP_,XdpW[npUVln,TRPMqN,PzG/HH K%V 8_:,PnpUVn,,P8PPnpUVU n6,6,P86Pn,PRP0n7,VH7,P87PWcWcP%o@,P8AP!RkwkwP"n ,LRP  " 9,#8,#8,sum:,$:% /usr/include/iso/usr/include/sys/usr/include../libcat.csystem.hstdio_iso.htypes.hstat.hstdio.htime_impl.hgetopt.hstdio_tag.hstdio_impl.herrno.hversion.hexitfail.hprogname.h0GHH{9] :)fi|+:bej4T qtvrrrrrqV7GL40xGy:I%\qbgrr: %vq c 9.~+~cG~q{c9|+8,3n8,-s<r~ Gswnr r`x4Uq7Ie4 /fŪTV+Ghc~~q+~c}u c^9}c cegdHb:0 d*dd.9*,hceV%9 UUW\:8G2y$sZYH\H:8V-:8 +y9: HdUb:lH l-@V?K V~V>&8qIU7q<JD{%~++~{U~V&V&=~UZ# version.cY /usr/include/iso/usr/includefull-write.cstddef_iso.herrno.h=;:+r+9vUL,,Kw E progname.c=" w+ 9: c /usr/include/iso/usr/includepropername.cmbuiter.hmbchar.hwchar_iso.hwchar_impl.hstdio_iso.hstddef.hstdlib_iso.h`>18,sTdg9e,8~rd+GGd8,:-qb,,f,,9Ԝ%tQK&%ŀ8~+qIeV8~rd+GGzczG+zqs1 Cu\0I* r5KVe n/I( r5Ke qVnpcGq-V8~rd+G[oGGcV8~rd+GG% q u)ndI( r)]$5K\PI( r5Ke qw q& ]B$n;t*+w&|.V>P0 U;Vtty2):/&> +-\8r9+9U++9$.W]? /usr/include/isostrnlen1.cstddef_iso.h$KU:F:dX(,X  /usr/include/iso/usr/includetrim.cmbiter.hmbchar.hwchar_iso.hwchar_impl.hstring_iso.hstddef.hstdlib_iso.hPK)S-fʫ3;e,8~rd*G$:rd)8hD.-ce,8~rd*GGa#cG#iU Uo8,&dI  5K]dI  q5Kwr, rd(B qw q B /usr/include/iso/usr/include/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeversion-etc.cstdio_iso.hstdio_tag.hstdio_impl.hstdarg.hversion-etc.hxP* G-<x# czqvUxyyzzzlU<6=hhd+% version-etc-fsf.cF. xalloc-die.cexitfail.hTR dc /usr/include/iso/usr/includexstriconv.cstddef_iso.hiconv.herrno.hR!d;t6wdtDydtR? /usr/include/isobasename.cstddef_iso.hS L(.I,y+sSX( U;GK t+WGU:h40:ŀmdqƚp9 /usr/include/usr/include/isocloseout.cerrno.hstdio_iso.hstdio_tag.hstdio_impl.hexitfail.hS*%d# &;yG) /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/includeerror.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.hTc+U+Xdvsr* +#c9#  c +8:48:G R.(+f0d cɸ+Z*:%N$ exitfail.cA /usr/include/iso/usr/includegetopt.cgetopt_int.hgetopt.hstdio_iso.hstdio_tag.hstdio_impl.hVqdb9+:`\HF,(:6.:53GqIH8,*:`!5kŎVTf;Esc@s99Gcʅ~99q[dW;e7eM T-Uz@s,0z  2z9rrrtI UZiq!r9z+zUUzUG+hV dW2U-y8:8:<*+<({H8H*;qU}x G9~UU0x2:8rU~U y9rrru<.+&$I]mq'c#9rV|qǎ~U}8::'FU:/79I+~'U~8:~d8:8::c*G:T}(+~e}x58::~2&q$|3&}0q,+yV**i`X6VX: Gd_9 getopt1.cgetopt.hgetopt_int.h$d)d?d Gd?dM! hard-locale.cd$);eRX +T,0N.F,:v /usr/include/iso/usr/includembrtowc.cstddef_iso.hstddef.hwchar_iso.hwchar_impl.h`e;)e+J*ǁ:xUGU}TtqVS9`U Ue9r; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.h frdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnGbebdbfTV]U/I- r5KVLeVT~rd+GuG:b:bHcs7 ىue qn/I- r5KVe bo)8:l) q BC$gcgcg9UGGcVT~rd+G9%czrbrT~+q/5c+q9(T~s6 5uV9c5r,gԞ}e HZ3 +j,xfwG-e9~:* r-cqc-ŀT~+q&dd](#95Ve}eos~+<q~qcT~+q GwL~4ŀT~+qIŏT~+qd~_s6 5uV\s6] 5uVe w oVs7 c/ B bo+  uyds: 5um .d  qnc~m Jcs: t(15K5uxt~n   to+nU \b /usr/include/iso/usr/includestriconv.cstddef_iso.hiconv.herrno.hЗ-z909a+dczUh9du#*uT,cg99g+ddm JK:8,; +gXQ&t8dd;SbUUqp99rrye)-2s+~cz;)H Us+~UӍ:8d-7q\:*XS- +  +J6p8deTu8dd9r+X? /usr/include/isoxstrndup.cstddef_iso.h dt)y /usr/include/iso/usr/includeclose-stream.cstdio_iso.hstdio_tag.hstdio_impl.herrno.h@9:H~d eHCY,]> /usr/include/isostrndup.cstring_iso.hVb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHF /usr/include/isomalloca.cstddef_iso.hGK;Iu?vs +xU3hWMoU:~d-kv9qv9:VOx+ /usr/include/iso/usr/includembslen.cmbuiter.hmbchar.hstring_iso.hwchar_iso.hwchar_impl.hstdlib_iso.hctype_iso.hP8,eV8~Grd+G~G:TVU0I(] UJr_Ke qC/G 8:)`" printf-frexp.c<Ax9Ae|,;GW9+q+9- printf-frexp.cfpucw.huc~, MzFz+!RWHb,kE,o-sU z9.do-U isnan.c\9 tG GtU G,>qCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.h|y9:trsdrT:grq|qX   .T. .. .. .. .^... .<xrpl_optindPrpl_opterrbrpl_optoptfo)Drpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_r,hard_locale-rpl_mbrtowc,/1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals];safe_read]<safe_writeb=,stpcpy=Erpl_vfprintfe:@gxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdupB:c_strcasecmpCyNfseterr! Edflocale_charset!qHis_basic_tableI$mbsstr>Qmem_cd_iconvUstr_cd_iconvstr_iconvbUExstrndupVNclose_streamWrpl_strndupXvasnprintfuDrpl_wcrtomb%vrmmallocafreeaJxmbslen{Vprintf_frexp {hprintf_frexpl<}rpl_isnanl#~ printf_fetchargsprintf_parse0  =M =jK `> $K,\PK%xPTR+RsSST "Vu o)$d,d-`e,/ f ];sY]<xsYb=s=s:@t'BuGCv  EvIzQЗPbU V@mWEX91u4evJxP{<]{<}\^~|   &, &  ,    H , 6 3AM/ \ 4 #*:t*:t #4:t4#8:|4|t ( l : "dql ( :   H M O .L u?u zYq?YzLqYzqAl`t:u; k  4 q  l k {+uk ; 4   q l k 8{+0Huk ; Z   q ^ l . R #k qv+0^|*^8U64 o ~Y ~`c@ ` e T [ _|$2cmcm]V i - o mk\a- o k\ q  o - i - d Pd $ 2d $ o $  j6}" & Ij"FV6h l * d | "IV}F \ Vw%F @"IF` F+j..@"IA@w}%F+2@%F9dH^G^Hj gq8HgqTNPE~1~P4CHP~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@Olztvp8zzp(xT #0~T #0< m0#< mX#1u 5< AuFy0/"0GNU C 3.4.3 (csl-sol210-3_4-20050802)cat.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntpad_ptr_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned int__longlong_tlong long intssize_toff_tshort intshort unsigned intu_longlong_tulong_tino_tblkcnt_tblksize_tlong doublemode_tuid_tgid_tdev_tnlink_ttime_ttimespectv_sectv_nsectimestruc_toptionbase_namehas_argstatst_devst_pad1st_inost_modest_nlinkst_uidst_gidst_rdevst_pad2st_sizest_atimst_mtimst_ctimst_blksizest_blocksst_fstypest_pad4usagestatusemit_bug_reporting_addressnext_line_numendpmainargcargvoutsizeinsizepage_sizeinbufoutbufargindout_devout_inocheck_redirectionhave_read_stdinstat_bufold_line_numbernumber_nonblanksqueeze_blankshow_endsshow_nonprintingshow_tabsfile_open_modelong_optionscontin_Boolio_blksizesimple_catbufsizen_readptr_alignalignmentbpinbpoutnewlinesremaining_bytesinput_pendingwrite_pendingn_write__iobrpl_optindsaved_errnoVersionexit_failureset_program_nameinfileinput_descline_bufline_num_printline_num_startline_num_endnewlines2version.cfull-write.c/opt/pkgs/coreutils-7.4/libfull_writeretcounttotaln_rwprogname.cargv0add_slashpropername.cwchar_t__mbstate_tmbcharwc_validmbchar_tmbuiter_multiin_shiftmbstatenext_donembui_iterator_tmbsstr_trimmed_wordboundeda_stringfirst_char_after_tsubpfoundtsub_in_stringstring_iterword_boundary_beforeword_boundary_afterlast_char_before_tsubtsub_itermbuiter_multi_nextwith_shift__func__is_basicproper_nametranslationfinal_resultproper_name_utf8name_asciilocale_codealloc_name_convertedalloc_name_converted_translit__ctypeis_basic_tablestrnlen1.cstrnlen1maxlentrim.cmbiter_multilimitmbi_iterator_ttrim2mbiter_multi_nextversion-etc.c__gnuc_va_listversion_etc_vaclose_streamcommand_namepackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cxalloc-die.cxalloc_diexstriconv.ciconv_t_iconv_infoxmem_cd_iconvsrclenresultplengthpretvalxstr_cd_iconvxstr_iconvfrom_codesetto_codesetbasename.clast_componentsaw_slashbase_lenprefix_lentmp_lengthcloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineerror_print_prognameerror_message_counterror_one_per_lineexitfail.cgetopt.cREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optoptrpl_optarg__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptexchangebottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlyprint_errorsnameendexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalrpl_getoptgetopt1.crpl_getopt_longopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardmbrtowc.crpl_mbrtowcinternal_statequotearg.cc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_styleclone_quoting_optionsset_quoting_flagsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingquoting_options_from_stylegettext_quotemsgidquotearg_buffer_restyledquotearg_bufferbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimleftquotearg_alloc_memxcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_valsdefault_quoting_optionsslot0nslotsslotvec0safe-read.csafe_readsafe-write.csafe_writestpcpy.cstpcpydestvfprintf.crpl_vfprintfformatoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupc-strcasecmp.cc_strcasecmpfseterr.cfseterrlocalcharset.clocale_charsetget_charset_aliasesdir_lenold_res_ptrres_sizebuf1buf2mbchar.cmbsstr.cknuth_morris_pratt_unibytephaystackrneedlerhaystackknuth_morris_pratt_multibyteneedle_mbcharsout_of_memorymb_copynew_mbcold_mbcmbsstriter_needletry_kmpouter_loop_countcomparison_countiter_needle_last_ccountiter_haystacksuccessprev_failinptroutptrxstrndup.cxstrndupclose-stream.csome_pendingfclose_failrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_floata_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerargumentargumentsdir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointpointbufvasnprintfresultbufout_of_memory_1overflowbuf_neededlengthbuf_malloceda_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharactersremainingtmpbuf__x_ntmp_memsizesign_value_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombmalloca.cmmallocanplusslotfreeachainp_beginmmalloca_resultsmbslen.cmbslenprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.4.rodata.str1.1.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo  A'   /"} 7o\$\$Eo$$xRot&t&c l(l(@o B(( s**x..~ 2E255`X((  `!' @  /O8)FIpR\5^T k$" {+0`0*Px h0707011d719d59000081ed0000000000000000000000014a5bb2cb0002ca4c0000012e00000002ffffffffffffffff0000001900000000root/opt/aosug/bin/chconELF64l4 (,+44ox\ $$X/usr/lib/ld.so.1  #$%&()*,-.014689:;=?BCDFGIJLMNPRSVWZ\]_bcefgklnpquwxy{}~ !"'+/2357<>@AEHKOQTUXY[^`adhijmorstvz|  +7 A 8 MU_jxH  JL lJ  J `KI K1 KY PN@ NNO WOx bXP kT ~Wn Xi ${ ~/ ~ ~ H2 4|, B" [dQ n} %21 EOYhx_ P t PE   HX. ]d4c46iD {D5v& 4  5zQ $H  !  y0 -44-37T  D  QD= [a  iL  uJ ~" dxL 7 \ y` 1 $& 45@  H (- .`I <T6C$ ] Le XDm e2m _ 3$3M 3% l :6   T4lG 26 Hvb  5)  + $ Hk 3*  ; L# E D^ T x j   } 3 DzD D6 `/ 4 $ T  5 3 5 ^  4 d6! 5 F  $ / D 8 x K hw W D4_ . j @w& ~ `   T3 ؏  ̌G (N' () H  zH ' ,7~  3 z. D3  TG  ! $4( T50  9 FF H 3P (FZ k x ` 4 D X    6 t3 Ȗ%  x v# `L  t2 " / 36 } @ p8 F d3L h $$ z {  2 } Ȅ\ \  74 ?Q 4 43 ' x , 4 {m 4  2# Hj  6 t6> I O 25Y `G  chconfsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummychcon.cversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cerror.cerror_tailexitfail.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt1.chard-locale.chash.ccheck_tuningallocate_entryfree_entryhash_find_entryi-ring.copen-safer.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.cselinux-at.cvfprintf.cxmalloc.cfseterr.copenat-die.cxalloc-die.cxstrndup.cclose-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.copenat-proc.csave-cwd.cvasnprintf.cdecimal_point_charwcrtomb.cxgetcwd.cprintf-frexp.cprintf-frexpl.cchdir-long.ccdb_advance_fdisnanl.cmemrchr.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.sclone_quoting_optionsget_quoting_styleset_program_namestrnlenfclose__longdouble_usedquotearg_memquotearg_allocfree_cwdrpl_strndup__environ_lockbase_name_startfwritecycle_checkdup_saferprintf_frexpquotearg_colonprintf_fetchargsopenat64getenvhash_lookuphash_rehashxcallocquotearg_free__fpendingsprintfget_root_dev_inoopenat_restore_failstrncmp__fsr_init_value_get_exit_frame_monitorVersionlsetfileconatquotearg_char__umoddi3hash_get_max_bucket_lengthquoting_style_valsrpl_getopt_long_onlymemcpy_endrpl_getoptbase_len__1cG__CrunMdo_exit_code6F_v_fstat64xfts_openquotearg_n_style_memqsortldexpquotearg_char_memiswprint_getopt_long_rrpl_opterr_lib_versionfchdirlgetfileconatquotearg_alloc_mem_environrpl_mbrtowchash_do_for_each_DYNAMIC__ctype_Jv_RegisterClasseshash_get_firstfstatat64i_ring_emptyprintf_parsex2realloc_finifseterrrestore_cwdfd_saferrpl_getcwdhash_table_ok_mcounterror_one_per_linehash_get_nextvasnprintfquoting_style_argsxgetcwdopen64errno__deregister_frame_info_baseshash_deletequotearg_n_styleerror_at_linestrspnxstrnduprpl_wcrtombclose_streamgettextfts_childrenrpl_vfprintffputshash_insertxmallocmemrchrbindtextdomain_GLOBAL_OFFSET_TABLE_quotearg_stylexreallocclose_stdoutatexitwcslen_getopt_internalstrchrxalloc_dieerrorcycle_check_initfts_closeversion_etc_vahash_print_statisticsquotearg_style_memstrerror_rhash_get_entriesversion_etc_copyrightquotearg_colon_memxzallocerror_message_countxstrdupfflush__assert_c99rpl_isnanldirfdmemchrfcntlversion_etcrpl_optindsave_cwdhash_get_n_bucketshard_localelstat64open_safer_getopt_long_only_rerror_print_prognamequote_nquotearg_n_memquotearg_nquotearg_bufferfts_seti_ring_init__fsrrpl_optopt__flsbufhash_string_etextclose_stdout_set_file_namememsetmbsinitquotearglast_componentmemmoveemit_bug_reporting_address__dso_handlefts_readreaddir64i_ring_poprpl_optarg__iobprintf_frexplwctombstrrchrxmemdup___Argvhash_get_n_buckets_usedrpl_getopt_longi_ring_push_PROCEDURE_LINKAGE_TABLE_exit_failurestrcmphash_freeusageabort__register_frame_info_basesset_quoting_flagshash_reset_tuning_exithash_clearset_char_quoting_edatafdopendirsetlocaleopenat_save_failhash_get_n_entrieschdir_longclosedirhash_initializeset_quoting_style_getopt_internal_rseekdiropenat_proc_name__fpstartclose_stdout_set_ignore_EPIPElibc.so.1SUNW_1.23SUNW_1.22SUNW_1.21SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/libw y y y y '=  (=  qN  7                                     eYc1 !!"$,  %o(()*+p`WX*012^r3]}jv|t $wgh._aFL&k~b \{m0#$X,4C@ WH n (X08C<a@uDcHdLPTX\`d|hlptFxf|;El41"qV7,?o 5~\ $5 %%h%h%h% h%(h %0h(%8h0%<h8p%@h@`%DhHP%HhP@%LhX0%Ph` %Thh%Xhp%\hx%`h%dh%hh%lh%ph%th%xh%|hp%h`%hP%h@%h0%h %h%h%h%h%h%h%h%h %h(%h0%h8p%h@`%hHP%hP@%hX0%h` %hh%hp%hx%h%h%h%h%h%h%h%hp%h`%hP%h@% h0%h %h%h%h% hjj$t Rhtt PEu TRU RP"衰 PPURQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[ORxt :tҋtu鋃t Pƃx]ÐUS[P$tSj|PPpt,t pP]USP]t,P5Ph fZYPhi S555hH0$HYXhh$?XZhh$&YXhh$ XZhh$YXhh$XZhh$ h)Q5 YZPh?q$ hZhVhR$jXZhhH9$a$= 5 ZYPh$UWVSu 6]EEEE YXh(jXZhdhZ1$Z$lG jh h|VSB< t]lGL.=~/Hq jh h|VSE; u=I}E܅؋M)Ѕ@6HB P@ 0UPh~ Pjjq MȃH hU5 hvHPh! P5@ j v)tbr4X Y=K E6RLPEX ==X EfhEvX EE{X gE^9^ h Pjj  j'E܅E؋M)Ѕ~EąE u@ 0FPhN P5@ j= JMȅWjMuPYE u"EMEM@fQ8u}Eۋv ]u}wV$EH,u P 3 uEPhf PUrjU M1fQ8f= EɋPE=QPEPuRRQEl uEPh Pjj 1ۃ=tNÅEà uj!E5@  uW 1$ vPjuu~럄t5UBRUEVM13E FM9u% u"DPhL Pjj h|PEPuR2R=@ = uCPh P@ 0PPhM P5@  uwC[^Ph&$> EɋPE@ 0a u*CPh Puvj1ۃfV8n=W uBPh P}wjr1ۃfW8=5ut9UBPRTtpVt13p u A}9G@t,d h PjjuhjAPujAPh Pjj h| Pjjr juu [u11@ WjPup s}h=}@Pjhh5hVhhjthj@Puj@Ph Pjj j t@Ph h4J P5@ j91ۃ uh@PhL Pjjr h8 Pjj hd PjjXj UWVSj/]S$]t@EE)؃~0uu]Duve[^_UWVS EuEEEM }1ۍV Cu  WuQhHu hhT Ph`uXZuh$ w$, uh`E EEe[^_O uhփ uhɃ uh뼃 uh,믃 uhT뢃 uhx땃 uhX눃 uhtx uhhwWuhuUEPuuu u Uh)h$ hZhVh$XZhh$SD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$VQe[^ÉP</ZtPSPe[^Ív@PSD$ÉD$ÉUhPta=t =@  tO hRtM P R`IPh5@ j" P hSPuÉPh5@ jUWVSu uhMT u?H  huue[^_ÉRhSVt hKƒPRhhEHyvhj w WUh` tЃEPuU EQ5hhEPuU EÐU\ VSu]t95t\5 h` tSVStjPhK[^EPuU EGe[^Ð9tSPtP5hhVSuUWVSQl$|$]MGW11 D$u9Et D$Z[^_]ÉD$D$Z[^_]U1҃RE PEpp)UWVS,@(Eԉ׍r@uVR҉UtDZ,x=MԋI0QA M̉ E̋XVF11 u G@U9BtHe[^_ËB@E؋FVE܍E؉UPEp0(7t3 Pe[^_ËMЋA@B]ԋK0]ЋCPSTQUSR S7u, S+8x PC S7tԋ]ÍvUVf~8 Su1Ʉ11)[FtVx^vUVS։Ë@9Ut9u!C(ux Pse[^ÐPC4P;7ӉSt+vUSQv [Ppۉu]ÉUWVSuEPcÃ1tLPVWPYEƄC(@Cs0CfC:fC<C C؃e[^_UWVS u1t1CuC RC,y߃ SF vXvF(tMFx PuF4F,uiF(tPF0ug V:1uce[^_Ðuƒ vYt=@  vwf v0맃 P/뉃 P/닸=@ 됐D$1t$ÐD$D$9ÐT$ v@ ÍvD$fP<1ÐVSD$ D$rTHT9΋ZPPPrw9r9rw9r1[^[^UWVS ӉƋC,U{@uNF(tJtHWsPtQ5@ t~sPhjW= e[^_ÐF(uuhWsv uaW@t_ t1e[^D_ÍvWsk @ s@ CPvF( Gu.C4t e[^_Àt%=.u؋C,USQË@9v' sC@ N1]ÐSRs)t C]à sz1CUWVS Ƌ]@$9^ ׉Es)C(=?F wqPvt[FvN @uujSvN9KuvAKBuBe[^_à vFF e[^_ÐUWVS] EEG55 jTƃ1(PjTjVEF$؃tU:1ۅF(FSt)}1}щH9vÃEuݍSsYM_EEF)1ۅEv1щH P"M@,H}G-%fG8 #E(_EMEs}t } j(@XF(f@8  j1҅F0t PEF(u6u1%Ph0FAjF4P/e[^_Ð@ 1e[^_Ív jfG8EGEx}E* h3h JhlJjj' 1҅F0@  u v V|1! j(Et@,Eu uډÃ'}N(UWVS] ۉTPƅNt޿tITR(NO@tPt]x uv1e[^_ÉTR(ƅNNO@uMzU҉D@u!މ׉XPDu=XP9B@uZTJPhl11 t%@ E/e[^_ËT@(@@t0 1OPTDe[^1_É Dƃ늍v@%@RPSTqƒ҉D^T(@Oy@iT 4VM,tGT(@<PS,{ @ D@  VN,ƅOxTI(1ۉE@T@(@vUWVSLEUUE܋B(uur EpEԋEԅMfy8 }<MQ(titdE܋@\ EuEċEąEuP}DPjMqrBƃ1x VN;fEE u4UB)tx. P@ÃxjSU܋Em}ąt }q EfH:EuMQ(tx SEP(M܋I$MM܋AEM|/u4IM.EEEEP(M܋I$MM܋AM|/t̃EtUEP/BUEMIE)U܉MJ,AMEEEEEԅ6 u EE@( u Uz.]1у IQڋEV71I;M1ыET9MȉN,MMFV$QFPE@(VT0FUJ$t B)[fF8 FX1Uąt t E)EĉEFbM؉quEEԅ}teEXPJ9t +JBZRuUB,x.J9t +JBBZuB‹B,yԋUB(tM9J}E}t4}tuu2U܋Z,WE4MA(M}'EP$@)Ee[^_ÐURUйыEE0UB;EtB(EtEEMEI)M1ыET9 VSE_uBEM܁H( fA8@ N1e[^_ËFFSF0@PPu-B<.z jEfF8B1Ƀfv ftMQ(E Eu؉uM* @ VcE^uRMU܁I( 1fB8@  u$IUr$6}, uUEE jʋEU܃fB8M܃QhjEE܋Uf@8J( E1e[^_á@ M܉A jStH @$PNuUUEB$N @ V'@ }iMfA8[}YUܡ@ B1fB8C EpUWVS u }t 1G) @ fS8f 1fJGK,C8/W(%RPhwEEG)G jUGve[^_ËCe[^_ÐwGe[^_@ 1e[^_vO(fPhz#N u~u u ]3P~,ofF>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PupEM$@A}VuFuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7Wh>ZYPhAU$?r뵋Et)M x-t}Pu EtBU x-+ U$rPM 1ShZYPh }$E$U$@(C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2Ph0蜿^_Ph蟿UȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1QhP_ZPh}$ }1}ыELU$JMA B?C}]ȉ}EE t0Sh膾ZYPh艾U$RUCVE 0ShWZYPhZcut$E t0Sh'ZYPh*M$Q׊EэLE$HU::M 41Sh5ڽZYPhݽ}$GE!VE 0Sh詽ZYPh謽N]M$Q1ыE$LH?}71WhO[^PhRE$@ESuuTE$P1ыE$LH?}7E 0Qh_ZPhMM$} 47Sh0込ZYPhUhu uuuuu uX  ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuV踻tw P能tehjV茻tSPt(hlVftSPջu1SV@$Ȼe[^_ËD$@ËD$@ ËD$@VSD$ X19v*vtAB@u9v։9w[^WVS|$_119vtFABvA@u9w9w t1[^_9Ot1UWVS u[[u@Yu=ZuBWhru E Vhu 1҉$S,$1҃RV,$ $ShTu ҹuhu 迹e[^_UWVSu} vWVƒ9Fv<1҅t3WVu[u1ҍe[^_Ëe[^_谹UMQ1tIv9vt耹UVS]su VS‹K9v7Ѕt90t"@vu 9r1e[^É@tڋ UWVSD$p19ދl$|$v"t9sRDAu9w[^_]UWVS E0@19v0t"u3U t[GuUB9wэe[^_ÍvVSL$ t$1)1Au[^ÉWV|$ ^_ÉPBEuEt1AÉB Euu+BEuuEuÍvUWVS,}] M j(ƃ1*^'{u?1ҋERP,$sكtn}fE fEm}mEE}wKM vY 9Es1҉uԅtEԋEԍ@9ˉEr1҉uԅu.؃ Ve[^1_ù 렻.Nw΃jQI‰tF‰FEFEF F F~F$e[^_ÍvUWVS }7G9vzvtj^O SG$҉C_$t,t 3ыSG$҉C_$O u׍vu-FG9wG Ge[^_à 6уNjO 뾉UWVS EP ҉Ex8@9vh7t#t 3MQ [uUB9wЋM9v-v_t sSluUB9w֋MY$ sS@u E0*UUe[^_E@낍vU@$t ‹@A$ɉÐ jƒÐH$JP$UWVSƊE EvRVƒ9^E1t&RWVt4};t KuIe[^_É0WVu[Cue[^1_ËS}:tŋBC QSʉ>譳UWVSEp pppu ǃ 1UB$G$EB;EvUtqv;]FC^]tKwPEW4ƒ9wSɉUuUG ;]tډ}]uUBE;Ey E0,UGBGBG B G$B$<$e[^_ÉtEFBV7p1UVS] ۋu%jEPډt e[^ÉEu;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]su蚦USPMɋU t1 APq1u@ uE@  ]Ív ȐUWVS}M@ WɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU @ tUEe[^_ÐU덿 nUuju uBÐUVS;5s tȥC;rF=`t P詥`t V聥e[^ÍvUWVSƅ@ UE#95wyVEUE}PPP}ãtS=M)1<EE UP|PRE؋E 0uUuUi 9EwI@`Et We u_Duu܋U 2uuU E@ e[^_É1责CvUh EU jÍvUh uEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<}  EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUShPh]ڢ1҅ux|hSCډЋ]UVS]SE t78/t2RPSVt29t P@ 0@ 0e[^à V uR Su( V@ 0 u6 V% 뜃 V@  @ 댃 5@ 4 5@ NUVS]SE t78/t2QPSV t29t P@ 0@ 0e[^à V uR Su( V@ 0) u6 V9 뜃 V@ % @ 댃 5@ H 5@ bUVS]SE t78/t2VPSVt29t P@ 0 @ 0e[^à V#uR Su( V@ 0=u6 VM뜃 V@ 9@ 댃 5@ \ 5@ vUVS]SE t78/t2RPSV3t29t P@ 0@ 0e[^à V7uR S#u( V@ 0Qu6 Va뜃 V@ M@ 댃 5@ p 5@ UWVSuu PP}DžƋtRWSjPџ9rۉx1e[^_Í9t @ V@ @ O WUS]St]ÅtvUS ] Su)t]ÐtvUSR]M ۋtsB‰U ]X[u@wvUS]S\ SjP脝]Uu ukt1US] S SuP菞]ÍvUW U1QR}UVS]PuE PSt e[^Ð1҅tK8uut7 h(Phv Pjjie[^\D$H Uhx< PuP*蕛Uh PuPmUhPhjPְAUu uctUVSuV/E^ 4$-ut+}u =@  tu @ e[^Ée[1^D$@ @@ÉUWVS Exth j1҅ Ru=EM 9sP99$)čL$PDžLE} u?@8<DžP%Gt'Gt-Gt+Gt Gt#Gu/ t0GDA Q9t)RSPW߃DCS9t)VSPW߃  $< < zl<$۽1ۭ[E@Dr(tD82D8D8f0D8D8@LGDF$G%GnGDžu/Ft'<mD`DžDB t+<8D`A8;8s;<< t&<;80KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt Ju0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 -3F<vF<w Dž:\O AOu\8ml<$۽ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @mLt Ll ul|1@ XDE |nKI;w0CJu + |n 1ۃ؃w ICNCFC? /97)=~YRhj/V)=uE/u2ChS1d4)=9saEtSE@ x Pxaa@ hUhh5h_cj u`auEx Pau1hLjƅPjhTu_TXƅSRP=_Lt Lj_rlX$D9h ( T^L  P^TƅS @ L^.atW11 t thXQWT]up%=@rD9X`lh11 F0+41эq9w~E 2,9>r,9,P4^],+ ;WPQ)RL^04)0PV0$^00/(H9ʉD $m$ 3<38 MLt L]4,B;0+0WS04[u MeE8U҉4) ,[441Ge<. @ L?\S@ u9t0ƅjL]XL[@ u @ Lt L[StH TZ5<811 {@ e[^_Ë@ Et@ e[^1_Ë4EE̓ 4)ZσS4ZEUz0B/@ %@ > @  "@ "L$(D$ L$$D$T$$%T$u D$=tD$ÍvD$5 $VSQD$L$D$D$ȅtvt HT$8tXIuD$ Ɖ ƃv#1! u$w߉ vHT$8tIu1Z[^ÃUWVSl$E1t$]t#wP$|CG9}w[^_1]ÉPCS܉fCωC[^_]ÉHP CSK 롉uC덉{C`rUWVSHE ]EEEEj,WU B} MEAQ CC%uU M PAE 21 EEEsEEc E %E EF9sE_;UlURU> PP PO uOEEG E.EE E PwOEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt PIN@  AURU PNUWV(D$@T$DL$ ƅҋD$A>>UA>>AA>>]>EEEEEEEEzEmECopyright %s %d Free Software Foundation, Inc.?L??@ .Ld| 'lxЉddx99999mmmmmmmmmcycle_checkx^DҨΨҨҨpT8llllGlllllcdb_freechdir_long(NULL)g[[NN    <<<q        1QAK1~~aKKKbug-coreutils@gnu.org Report %s bugs to %s GNU coreutils/opt/aosug/share/localeHLPRhvu:r:t:l:invalid context: %s/.libs/missing operandcannot access %s%s: %scannot read directory %s-R -h requires -PJim MeyeringRussell Cokerchconmissing operand after %sfts_read failedlt-%s (%s) %s (C)Written by %s, %s, and %s. Written by %s and %s. Written by %s. %s %s Report bugs to <%s>. write errorUnknown system error%s: %s:%d: %s:..--POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous state->magic == CC_MAGICPOSIX# entries: %lu # buckets: %lu max bucket length: %lu "*dir != '/'`invalid argument: %smemory exhaustedcycle-check.c/proc/self/fd/%d/%s/proc/self/fd/proc/self%#.0f%+dchdir-long.c! close_failPATH_MAX <= lenslash - dir < PATH_MAX0 < lendir <= dir_end(NULL)recursiveno-dereferenceno-preserve-rootuserroletyperangeverbosehelpversionliteralshellshell-alwaysc-maybeescapeclocale7.4Try `%s --help' for more information. Usage: %s [OPTION]... CONTEXT FILE... or: %s [OPTION]... [-u USER] [-r ROLE] [-l RANGE] [-t TYPE] FILE... or: %s [OPTION]... --reference=RFILE FILE... Change the security context of each FILE to CONTEXT. With --reference, change the security context of each FILE to that of RFILE. -h, --no-dereference affect symbolic links instead of any referenced file --reference=RFILE use RFILE's security context rather than specifying a CONTEXT value -R, --recursive operate on files and directories recursively -v, --verbose output a diagnostic for every file processed -u, --user=USER set user USER in the target security context -r, --role=ROLE set role ROLE in the target security context -t, --type=TYPE set type TYPE in the target security context -l, --range=RANGE set range RANGE in the target security context The following options modify how a hierarchy is traversed when the -R option is also specified. If more than one is specified, only the final one takes effect. -H if a command line argument is a symbolic link to a directory, traverse it -L traverse every symbolic link to a directory encountered -P do not traverse any symbolic links (default) --help display this help and exit --version output version information and exit %s home page: General help using GNU software: Report %s translation bugs to failed to get attributes of %sfailed to get security context of %scan't apply partial context to unlabeled file %sit is dangerous to operate recursively on %suse --no-preserve-root to override this failsafefailed to create security context: %schanging security context of %s it is dangerous to operate recursively on %s (same as %s)-R --dereference requires either -H or -Lconflicting security context specifiers given License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous # buckets used: %lu (%.2f%%) unable to record current working directoryfailed to return to initial working directoryB=fff?̌?OO?A=@??$22222222 33*3:3J3Z3j3z333333333 44*4:4J4Z4j4z444444444 55*5:5J5Z5j5z555555555 66*6:6J6Z6j6z66w    , l  ` ` ``t-`o)o,+ol0,0Ho`o``6?`zR|0 L 8t  l ,,++t- ,0 l0 t2 6 ( $ x| !"#$%&'()*+d  *=R ]dp{ x|7  8 &. ; IQi-HU]H hx JL lJ  J `KI K1 KY  DQ^tlxxt PE   7 F \ Y y` g 1 r $ & 45 @  H (- `I T6 $ k] e Dm 2 _ ' 3. $34 M A 3@ % H l Z :6  _ u  T4 lG 2 6 Hvb 5 ) + Hk & 3  L# D^ x   Z  $ 3/ DzD S D6@ `/V 4 i $ q T  5 3 5 ^ 4 d6{ ! 5 F   D x hw D4 .  @w& % ` :  T T3B ؏ Q  \ ̌G l (N' t () H  ! H ' ,7~  3 z. P D3 TG  $4 T5  FF 3 (FZ ` 4D "X -3  A6Ht3PȖ% X`x xv# `L t2 3} p8 d3 $$ z  { .2 } )Ȅ\ 6\  4:Q A4K43U' fx y, 4{m C4 2Hj  t6I 2i 57`G  chconfsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummychcon.clong_optionsdev_ino_buf.0recurseaffect_symlink_referentspecified_contextget_root_dev_inospecified_rolespecified_userspecified_rangeverbosespecified_typeversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1exitfail.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt_datagetopt1.chard-locale.chash.cdefault_tuningcheck_tuningallocate_entryfree_entryhash_find_entryi-ring.copen-safer.cquote.cquotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.cselinux-at.cvfprintf.cxmalloc.cfseterr.copenat-die.cxalloc-die.cxstrndup.cclose-stream.ccycle-check.c__func__.0dup-safer.cfd-safer.cmbrtowc.cinternal_state.0openat-proc.cproc_status.0save-cwd.cvasnprintf.cdecimal_point_charwcrtomb.cxgetcwd.cprintf-frexp.cprintf-frexpl.cchdir-long.c__func__.1cdb_advance_fdisnanl.cmemrchr.cprintf-args.cwide_null_string.0printf-parse.clibgcc2.c.LFB3__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START_clone_quoting_optionsget_quoting_styleset_program_namestrnlenfclose__longdouble_usedquotearg_memquotearg_allocfree_cwdrpl_strndup__environ_lockbase_name_startfwritecycle_checkdup_saferprintf_frexpquotearg_colonprintf_fetchargsopenat64getenvhash_lookuphash_rehashxcallocquotearg_free__fpendingsprintfopenat_restore_failstrncmp__fsr_init_value_get_exit_frame_monitorVersionlsetfileconatquotearg_char__umoddi3hash_get_max_bucket_lengthquoting_style_valsrpl_getopt_long_onlymemcpy_endrpl_getoptbase_len__1cG__CrunMdo_exit_code6F_v_fstat64xfts_openquotearg_n_style_memqsortldexpquotearg_char_memiswprint_getopt_long_rrpl_opterr_lib_versionfchdirlgetfileconatquotearg_alloc_mem_environrpl_mbrtowchash_do_for_each_DYNAMIC__ctype_Jv_RegisterClasseshash_get_firstfstatat64i_ring_emptyprintf_parsex2realloc_finifseterrrestore_cwdfd_saferrpl_getcwdhash_table_ok_mcounterror_one_per_linehash_get_nextvasnprintfquoting_style_argsxgetcwdopen64errno__deregister_frame_info_baseshash_deletequotearg_n_styleerror_at_linestrspnxstrnduprpl_wcrtombclose_streamgettextfts_childrenrpl_vfprintffputshash_insertxmallocmemrchrbindtextdomain_GLOBAL_OFFSET_TABLE_quotearg_stylexreallocclose_stdoutatexitwcslen_getopt_internalstrchrxalloc_dieerrorcycle_check_initfts_closeversion_etc_vahash_print_statisticsquotearg_style_memstrerror_rhash_get_entriesversion_etc_copyrightquotearg_colon_memxzallocerror_message_countxstrdupfflush__assert_c99rpl_isnanldirfdmemchrfcntlversion_etcrpl_optindsave_cwdhash_get_n_bucketshard_localelstat64open_safer_getopt_long_only_rerror_print_prognamequote_nquotearg_n_memquotearg_nquotearg_bufferfts_seti_ring_init__fsrrpl_optopt__flsbufhash_string_etextmemsetmbsinitquotearglast_componentmemmoveemit_bug_reporting_address__dso_handlefts_readreaddir64i_ring_poprpl_optarg__iobprintf_frexplwctombstrrchrxmemdup___Argvhash_get_n_buckets_usedrpl_getopt_longi_ring_push_PROCEDURE_LINKAGE_TABLE_exit_failurestrcmphash_freeusageabort__register_frame_info_basesset_quoting_flagshash_reset_tuning_exithash_clearset_char_quoting_edatafdopendirsetlocaleopenat_save_failhash_get_n_entrieschdir_longclosedirhash_initializeset_quoting_style_getopt_internal_rseekdiropenat_proc_name__fpstart@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  : ;I I !I/ : ; I8 &I : ;I8  : ;  : ; I : ; I<  : ; ' II: ; I.? : ;' @ : ;I 1.: ;' .? : ;' I@ 4: ;I4: ;I 4: ;I U!1"1# $1%1 &41 ' U(41).: ; ' I *: ; I+.: ;' I ,: ;I- .4: ; I/4: ; I0: ; I1 24: ; I? < 35I44: ; I % 4: ; I?   I&I$ > % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% : ; I$ > $ >  I : ;I : ; : ; I8 : ;I8 I !I/  : ;  : ; I : ; I<  : ; ' II&I: ; I& : ; I8  : ;.: ; ' I@ : ; I 4: ; I: ; I .: ; ' @ 4: ; I  U 4: ; I ! ".: ;' @ #: ;I $4: ;I %: ;I &4: ;I '.: ;' I@ (.? : ;' I@ )1*1+.: ; ' ,: ; I-4: ;I. : ;/4: ;I0 U1 : ;21 341 415.: ;' I 6: ;I7.: ; ' I 8 9: ;I: ;41< =.: ;' >4: ; I?4: ; I? < % $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  ' I I & ' &I.? : ; ' I@ : ; I 4: ; I  .? : ; ' @ 4: ; I.? : ;' I@ : ;I 4: ;I 4: ;I .? : ;' @ .: ;' I@  : ; 11 1 41 !.: ;' I ": ;I#4: ;I$ U%.: ;' @ & U% $ >  : ;  : ; I8 I!I/ $ > : ; I .? : ; ' @ : ; I : ; I 4: ; I  I.? : ; ' I@ &I4: ; I .? : ; ' I@ % $ > $ > : ; I: ;I I.? : ; ' I@ : ; I  4: ; I  4: ; I &I% $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' I@ : ; I 4: ; I  I% $ > $ >  I : ;  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  4: ; I  4: ; I11&II!I/.: ; ' I : ; I4: ; I? < % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > $ > : ; I I : ;I : ; : ; I8 I !I/ : ;I8  : ;  : ; I : ; I<  : ; ' II&I: ; I.? : ; ' I@ : ; I 4: ; I  U4: ; I % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > $ > .? : ; ' @ : ; I 4: ; I? < 5I% $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' @ : ; I  I.? : ; ' I@ : ; I 4I4  11&I.: ; ' I : ; I% $ > $ > .? : ; ' I@ : ; I % $ > $ > .? : ; ' I@ : ; I  U4: ; I 4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% $ > $ > : ; I I: ;I : ;  : ; I8 I !I/ : ;I8 .? : ; ' I@ : ; I : ; I 4: ; I  U U&II%  : ;  : ; I8 $ >  I$ > .? : ; ' I@ : ; I &I .? : ; ' @ % : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ >  I.? : ; ' I@ 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ > : ; I I: ;I : ;  : ; I8 .: ; ' I@ : ; I 4: ; I 1 1 U41&I.: ; ' : ; I4I4  4: ; II!I/ .? : ; ' I@ 4: ; I 4I4   : ;  1 U1 .: ; ' I !4: ; I? < % $ > $ > : ; I I: ;I : ;  : ; I8 I !I/ : ;I8  : ; : ; I.? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U 4: ;I4: ;I  4: ;I  U4: ; I? < % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I 4: ; I U   I &$ > &I% $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < % $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 4: ;I 111  U4141  .: ;' I : ;I4: ;I 4: ;I  I&In :Dp8'/MR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intKc   G$D7EZDew% LlRa>[  gs~ nx t{ z~ ~ >* ; <# =># S E> E##m# val# %  # # # # # #  #$  #( #, (#4# *#<+ *#D3 *#L; #TF #XP #`Z 5#p > E > E % E % E k  # #sk}  !k# "# ## $# %{# { E} 'htTE#F#G#H# I# J#K# M#,N# 7O#$B#(N#,m#0w#4Em###># #####  #$#(3#,#0#4 S#8S#:S#<&#@0#FTS  E9@@Pp8:UKOS@88Rn{ m::DUrSw{ V|`\ok{{H{WDP  ! V;`;" #:;;($V ==" " $P =?% P" & S& @'X& $ $>=>") "4 '&? &J &U &` S!v >@?% R"  & d( ( ( '& P! 9?@?" " '0( ( $g @@" ! @@" )  *s) *s*con{ + .{, -{ ,-ok/{fts1-ent5 )k {*fts*ent .ґ.3ӑ.8k /ok{q ) C*fd03.J. .W.l1 .K-.x)1 }^0]*ret]1 /ok_{.` -.}  G , E;27 2r22:22 32 4({4+{4 .{4f2 454&84594D:4T; V V E L4cGl  F FQQ2PR03\P3hS4 uRR*)/SUS**!/SUS3P '0''-35u 76w~-len7-max77 3,fts285 l09spk9dirk / m0' 0TWU%sp~%p~%fd0%dir S$ret0V& ~& 0~1 U:UU$sb`~4pVV**03P&0S!UWW& 0P' W _U%spp# 0l$dph$pV& d&07`$cur\&X&  T& P&0S& O& N&%H& D&C$len7& 7&M 7R$cp1y QR]4W1XjX*$*/0(3;V3GWo@&! 0Sh&( @P!ZZ// )bZZ*p*{!ZZ;4Z\[**!Z\[3R3S03TSp5b9 7 9fd609dir6 /C 80/ 9  P\5 9p--sp-h-tmp-ent/? -t2=  /9sp.9p.-len07-cp1?:0g zvXi intM$O[ R*JR*Y8%#a9J#f;J#l%HvvUr;%w;  ; < < =%F =% % ?%P, X%vvUrW%wW  W  r#$A;%&FrX &U%& Z%& `% d@l fwv7 intM$O[ #%#m#val%# O% U   (!%%# &%# '%#(r#  -%#. 5r#9 W#D [%#V d%# e e%#$ A *%vvU r(% w( F( c) Q )r q[ 3%vwU r0% w0 F0 c1 Q 1 d2q  A%w?wU r>% w> F? c@ Q @j J%@wfwU rG% wG FG cH Q H dIq7" xhw~ +Mint$[  %hw xU $9V &Wp'P ww 2%S + s& x MR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,c$ [  fl           R    R R! #$R# %!#z ) -z#.z#/z#/0z# =1# J4' 80(6Z6!#a77#@8#w9# :#O=B# D[# E# F# I!#$=Hv xxTvP|nxxTvPx$xTvP:$xdxTvPZ7QV>xXx7PRdxxTvWZ7RwVQ~xx7PxPyUv @wpZ RPyyUvVWZ7P7S"RyyUvQZ7R (RyDzU'vS'VZ*7R+7PY1EDzzTCvPKCYURDWFQZG7SH7RR^ezzUcv c odRfWZg7Vh7S'~z {T'Q@VSchR-%Y {"{TOYW${{TQOBRz^{}UOBS [W  PVxR|E |J|5z\S||Q`||`|| T S!"!"##4 ] }}U\WZ^!V$d!S e!R  }~UpZ!W!S !V !~~UQnew!R% &~~TP!R 1R~UVW  PFsZ!S!S&z RW& RW& (# !# !!u M3U22 4WZ5!p6!S 7!l&` @IRhVK!V$`Y!R YREUVSRPZ!t& x!Q$#OBz\y ARH&USRRVZ!t$#OBPeHa(t}  !#"##%#$%#%#int}',M$[  1}(QT ir1R Q iP _&T]T ir%_P e,`T ir+1Q val+P-%R.V9U ir81S:QMint$Dek[ gsr+:U HU3 HR P  ap# :ggM intpp 8Un%p v{M &p8MU%p- LPintP7GI!5IdzM$[ ( ,# % .7W( 1P# 4%# 8W# g7  r s,#valt#^PUo]e_%Sp` iPToh,qȄTopspPP |%Ȅ$To{Rc{i{%Suc}Qp~V%Qr%P %$HToQi%Rr%P 2 HzTPRo JJ|UMJSsPVSJPPN_,ʌUK@x,argJ, P%Ni,len,SJ,YYY19rxmn!cescPm,(YD2,RH8w>D7,W)Έj,R=JV1JWT7BF,̌U KC xC,R!argDJ D,!oEpGQeH%SrI,P B`U!arg^J ^, ^!o_paWeb%pd%lUe,S"bufg#ab$,%]&n, hS׍U!argQJ Q, !oR';w؍aUsv;Vi7Sg(9dU!n%V!argJp , F e%l"n07sv;Shn1,hYg ,`valW%\,P#bn$pՏU!n%P!argJR؏U!n%P!argJR , U!argJ (U!argJ , o (UU!n%!sPR!argJoH XU!n%!sPR!argJ ,oH U!sP!argJ Q  U!sP!argJ , U!argJ , !chPF   /U!argJ!ch  =1U!argJJ L4LU!argJ , Z Z J)_M$DE7EoDeZp% vLRv,[ gsnx>t{z,U; < # =,#S, p, Ly # y# # # # # #$ #( #, #4 #U#< +U#D 3U#L ; #T F #X P #` Z`#p , L , L Z L}  !# "%# #># $># % # % L}' <htBN<H!T E9# F9# G?# H# I# J%# K%# M3# ,N3# 7Ok#$ B%#( NB#, m#0 w#49E m9# 9# 9# ,# # # # %# %# 3#$ |#( ɤ#, 3#0 #4 h#8 h#: h#< &#@ 0#!9Z%ZZ`f!EFTSTq w L Z L9!d '|Uw%SF%% ;&Cfts(|V2 R2%228>usMR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,$[  rT fprP Mint$[  ϗUH-ЗU,HHt#intM$[ !#U%, C$intP7$CUn, s P M  X D#MR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,$[  2:DU 9V ?; s<S L=P : +!XMint$DO7EdDe kLvRk,[ gsnx]t{z,7;<#=,#SD#D##### #$ #(T#,#4#7#<+7#D37#L; #TF #XP d#`Zt#p T, % d, % t: % , % dk  # #k## s H# f,ΘT +P |w;|ИU :sb:  @a B  % :&|i%>!Mint$[ "HUfd!H"Mint$[ 'HUfd&HWf*HVe+HS:H|"intP7GIM$[ (,#%e. pC,U pwcBp sBvV nB,S psBW  O`  Y,l  wc\>p ret],P>|Pp;#intQ>M$DE7EoDeZ vLRv,[ gsnx>t{z,H;<#=,#S c, Ll#l##### #$ #(|#,#4 #H#< +H#D 3H#L ; #T F #X P #` ZS#p |, L , L Z L \ 6U buf5 fd5% 35\F7%x8UY3P% ZSXC%Wx(Hj~?Ij}LJg}bZZ L0 #WNN#U#int[M$[ bENLUcwdDS%kXNLlTcwdWR  % walUcwd`SP!U$ݜ?0intM$Z[ }ݜUsVn% len%Snew}P Z!$+06MU%intPZGl6$[ HZ  ( ,#H .cl 2            ( 4 D N ] i z      X&  `ay#b+c4dH:eZAflKgVidj lsm|nKoHqsuwxyz{} u6aHl/ ]#a#! _ O#arg_#/*:,9 4-# >.# /H# F0# R1# \2O# l3# |4# 5O# 66#$ b7O#(9p_C >O#dir?_# @O# AO# CZ B6U h6sUs( BSB=deXaey0]@XWNNDWObufsxhsxcpViOxdp_x% sxwOxOx^Qv^g^g^gP r~P!~Rn*Ox+O '! 'P-OG-sS  wHwHwOwHwfbpsWZwxargHP,!,"6OG6sSTZ "m|!m|" CO֡!֡PP HOGHsV ΢Ow MHNHxOOxPHxQOx. ( argYHP J argyHPb @ RX arg2 x3 x4 OSw< Ox C  bufJ ~K HP (  OV / zP " p  OG sVy Ƥ̤ "ߤ!ߤ"!`buf ~ HS n5 OW !" 6 OG6 sSL BH "[j![j"9   F wH HwI HwJ OwK HL OWM ORN +ytmpO sw^P swpQ sS OS S nsOS m nOS <DN] e}!e}"#  OGsS 0 "ͩ!ͩ"Y H HxHQ OV  L xM HxN HxO OxP HxQ OWR ORS +ytmpT sw^U swpV sS"arg^ HP >7Targ~ HPV Rt!tP!Parg[ \!] pad ORend sV!oq sQ0 OS`#n Og̬!̬" OG sW ֭  O1j H $l %l %l _ml w$ Hx- ]86 HPYYk\!"vq`argY HP Z{argy HP!P!Pxarg\!;padORendsV#nOy!"OGsW ͲRQ0P 9o R*QHPKDhQ`PcxargR#nO0`R0C!0CPOGsS GargyRSarg RST70argMZRTHarglRS p8TargGHR TpargAZR parg;HR \q OR6 HPE<O$ .R!".POGsS]arg ] wL  OHH!$%%_mwp bufw ~x HP "ּHOVn Ox` "  OG sVOUH"hw!hw"` HP V  _cw x .%V x m%-$]  % % p_m ;y!VR x q sQ Ej R6QP (E RNrQP$ Hx- ] \q OR6 HP06 HPdQXP jRQpP buf ~ HWqby!by"% OG% sV"!"8#wO@padOW4!Pp#nOQ!P!POGsS#rppsQendsw^swParg ] j;]qsQ qsQ? HP w _cw x V x $$  % % p_m y!oVxUPqsR oq sR 5UHOV!vG<sPO&[NO'aMO'gMO'mMO'sMO&y9O'a8O'g8O(sum:O+6?<6)*Y~*H+x)*H+x, &XO'aWO'gWO&DO'aCO'gCO'mCOs- :H@#?/intP7GIM$P[ (,#% e. 0,U sS wc> ps0P h ret+%P:%$/Mint$:[ #rUcwd$rP:H'%>0 [ intMu B: UxA:[AP$C,|,%0 [ intMu Ba$ B% TxA%\AP$C,SPDVW ! _cwFV &4VFV CX Y iZ,Q I%a%],b%[ _VV k%|%[,}%] ,%H?b&013Mint$@d]:[ rG&fd'H# NFH+U cdbES dirER C GHV ( 5K#:X]8cdb7XsM;x^s#%cfkH,U dirj}VelHP,UqFXlenqP >r}Wcdbspvt 1nu >derrHP }S J#[Sd HS(FK 5Kp ( 50KDerrHP }S Jy[SHd,#% J,cdb+ pU}sTV 2Hcdb1X!:HQ(V2 Mint$DO7Ed@d]De: kLvRk,[ gsnx]t{z,T;<#=,#S+ o, %x#x##### #$ #(#,#4 #T#< +T#D 3T#L ; #T F #X P #` Z_#p , % , % : %-.#/#0V#1# : % >:6H#7H# 8H# 9# DIR:4v Ubufuu fdH~4~;~~~~STdir~ ~stv~w~S !hdAW~̯~4~HP~ V4~  4 &HP4tmpfS%gW-H>:Hl)3j 2int` DD`Dg[ w%3;DA IH: jT xG` PQR mSw $T%P *>4lT?0^/lTs.f.n.%Qk5t7P}8S9~:~V c; ~P   int   ~*4intP7GIu[aMUP$[ cIK2  ( 4 D N]iz X \  `\ ah #b +c 4d% :e7 AfI Kg Vio dj  lc smj |n Ko% q sq u| w x y z { } uw a >\%Io  ]K#aV#!  ,#arg#*o6%%TB$vVa$oUi&,Wap'Sp` u+5intP7GIM$[ cI/2  ( 4 D N]iz X@  `@ aW #bl +cs 4d% :e7 AfI Kg Vi^ djz  lG smN |n Ko% q sU u` w xk yq zw {} } u [ P f > @ l % I ^  ]/#a:#!  ,#arg# * ,9 4-U# >.U# /%# F0U# R1U# \2,# l3U# |4U# 5,# 6P#$ b7,#(9 C >,#dir?# @,# A,# CR%UBQUdQ aQcpSUST,pU,luV,hW,dX,`0j~]@e^1cP_b,XdpWnpUVn,TRPM,Pz G/H`K%VHt:,PnpUVn,,PGPPnpUVU n6,(6,PG6P-n,PRPHn7,V`7,PG7PP%K@,PGAP!RP^n ,L 1R$1P  "y9,#a8,#g8,sum:,$:%-8t8intM$[ vI%uJ,~MH}Nd u'low'#'#2 s0 ll1 2 tT u8 vPQ w '!+x6ALWVbWmUxRPP `cPRPndrpnnddrrd0d1n0n1n2q0q1bbmwwm1m0V ../lib/selinux../lib/usr/include/sys/usr/include/iso/usr/includechcon.csystem.hcontext.hselinux.hdev-ino.htypes.hfts_.hstdio_iso.hstddef_iso.hstat.hstdio.htime_impl.hi-ring.hstdio_tag.hstdio_impl.hgetopt.herrno.hversion.hexitfail.hprogname.hp8GHH~9W$ :)fi~*o+=utIuVy398q  w qc<6{U #u 9TVd~75 UuUKUl 9%UpUP U`0VTm[t"[zUbH9YqTrt |c'k+9n+i ~66&MeJdr||ӐUTN+HXTI,+,3EW+KQ:<p++:,dZ?'J dT.SIMcf*o;!+yU\_99G;HrYxc8:v;8Vz+T U 9h9 + 9.:T:ye*:8I:8H8Isrrr 9t 9zcrvg*d.r: 9<t qH)t;ht8r>C*d :d+'9:|+q|c c**:-qU~8V1:~+J$y9@*rfdZ|*);rԎ9x ;)yjy9j+yy9j:*d c*S0. U,qq 9tU +wUsq&  sU s- 8d;)MTr*z%c+o99x۟9kUGxY*I*,iqrG,d7HpqIs)q q>l,v:7;tH:X0qHd Uw9 9x+Afnz9:v8d) ~Ӝ:~+|G='=*wG1g * Uz#d;7F:e ;dN29k3+ZWrz+$8dTt}ӓKyG/f c<,8Vjӝ :F:F,cGLG4+G,Cx*'=.:?y9,>)--*L UeVU~,|d+caVV)Yq,2.T:~c: 9*xGA/:8:gGH.~+~9q3c;8Ve Ŭͮ#;*He~9)cq#fq&:}.d8:;dr:*Vyq,(~V+|{dW8dd:vz&T*(f **,k6HWM~UA /usr/include/iso/usr/includegetopt.cgetopt_int.hgetopt.hstdio_iso.hstdio_tag.hstdio_impl.hXiqdb9+:`\HF,(:6.:53GqIH8,*:`!5kŎVTf;Esc@s99Gcʅ~99q[dW;e7eM T-Uz@s,0z  2z9rrrtI UZiq!r9z+zUUzUG+hV dW2U-y8:8:<*+<({H8H*;qU}x G9~UU0x2:8rU~U y9rrru<.+&$I]mq'c#9rV|qǎ~U}8::'FU:/79I+~'U~8:~d8:8::c*G:T}(+~e}x58::~2&q$|3&}0q,+yV**i`X6VX: Gd_9 getopt1.cgetopt.hgetopt_int.hv)d?d Gd?dM! hard-locale.chw$);eRX +T,0N.F,:p /usr/include/iso/usr/includehash.cstdio_iso.hhash.hstdio_tag.hstdio_impl.h xr$r$r#+KS-sfXHuGq\9LR,-Ih!tqX,C:T.L8,d8,d8,W;V. ōe,*JVu,.vUc<:*JIe( UW7;7;dpwdt,vrBUGLQ/&;e-I'=QCq q{/We-=q++gt,q+H @ev9 + *su9G)ō<(<:*: e:W;YiU[y+x:dwqGq:T,~9qc9.TH-d^rs=u0&>g:K@w+,A),Mq*M(9U+-Ur3/./D4'=C=:*KT:,e>(r,"z9?ze( i-ring.ci-ring.h(Hrr,8ewK+HF:;T:-I|IYGI::7::.mKxq{ /usr/include/sys/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeopen-safer.ctypes.hstdarg.hc:- U>5 quote.c d1d; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.hPrdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnG^>vuH!+VjX NG2sUFdW8zS>^>vuH!+VjX QG/sUFdW8zS>^>vuH!+VjX TG,sUFdW8zS>^>vuH!+VjX WG)sUFdW8z /usr/include/iso/usr/include/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sysvfprintf.cstdio_iso.hstdio_tag.hstdio_impl.hstdarg.hva_list.herrno.hH$z9=XR,e1 2y+3o8ddv J /usr/include/isoxmalloc.cxalloc.hstddef_iso.h+q:dtRH q:t`H Gq)-+t~9iUO G~q:H\i!) cq:Vq:r /usr/include/iso/usr/include/sysxfts.cfts_.hstdlib_iso.htypes.hstat.htime_impl.hi-ring.h&U:T,+t*,IV(H.i /usr/include/iso/usr/includefseterr.cstdio_iso.hstdio_tag.hstdio_impl.h GJ. openat-die.cexitfail.hdhdF. xalloc-die.cexitfail.h dX? /usr/include/isoxstrndup.cstddef_iso.h$dt)y /usr/include/iso/usr/includeclose-stream.cstdio_iso.hstdio_tag.hstdio_impl.herrno.hD9:H~d eHCY, /usr/include/sys.cycle-check.ccycle-check.hdev-ino.htypes.hstdint.hstat.htime_impl.h+H %9TeG~'GHT., 6 dup-safer.c!e\6 /usr/includefd-safer.cerrno.h&: Uxd7-Vd=C/v /usr/include/iso/usr/includembrtowc.cstddef_iso.hstddef.hwchar_iso.hwchar_impl.h;)e+J*ǁ:xUGU}TtqVS9`U Ue9rw /usr/include/iso/usr/include/sysopenat-proc.cstdlib_iso.hstat.htypes.htime_impl.h5;7-ecT,2d4h Gk9xU3n9][, save-cwd.csave-cwd.hq:s?z+*,2zV8:/yHdGHd]> /usr/include/isostrndup.cstring_iso.hVb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHF8 wU +cy,IIe*d"+d,dd2#-׮~y92yce:*h8 wU +8r(.eX+~sfT,i9Uh+t-F9U isnan.c 9 tG GtU G,>qCGt:Dq<y> /usr/include/isomemrchr.cstring_iso.hl.+rGGK? +:qxqs# qf,jG  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.hy9:trsdrT:grq|qX.D M .\..$.< H .[.[.|  D() DT ,D`L F4DD .6.| ,. . .| $$   .$$8 .| ,PE .  ,Ȅ\ X $$0H2 @,|, .<" .. H.,̌G &. < 9. .. $ .,؍ .LdQ V.w.  ... #.$ .$؏ .$ .$  .,(- .,X. .$  .$ .8D . .$  .$ .$4  .| ,LJ .| ,0 .,0 .,0p .,0\ .| 0H  !.| 4L% ..4L) ..4LD= '. .,L$ .,L  ..,LȖ% .,L' .| D .M.  ..|  $ | 4H' . ..4HЗ' . ..| ,+ ..| ,$  ..| ,TDm .|  0И .| $  .| 0,J .| 0t .| 0I  =.| 4D ..L .4l) ..| ,E  .| $1 .1  .V .../.. ..0A......6.o.;..2......| ,e .| ,0& ..| $t]  .| 8   | , _  .h , ......#...| 0 "  J.| , ^ A| 8rpl_optindPrpl_opterrbrpl_optoptf4Drpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_r7hard_locale8 Mhash_get_n_bucketshash_get_n_buckets_usedhash_get_n_entrieshash_get_max_bucket_length:hash_table_okhash_print_statistics hash_lookupZhash_get_firsthash_get_nexthash_get_entries_hash_do_for_eachhash_string2hash_reset_tuninghash_initializehash_clear4 hash_free hash_rehashu hash_insert hash_deleteNyEi_ring_init7i_ring_emptyji_ring_pushi_ring_popdGopen_safer$|H:quote_nquote%I1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals#VUget_root_dev_inoTIXgetfileconatlgetfileconatsetfileconatlsetfileconat\Erpl_vfprintfe5_gxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdupaJxfts_opengyNfseterr;_iopenat_save_failopenat_restore_fail>jxalloc_diejExstrndupkNclose_stream3:mcycle_check_init"cycle_checkpdup_saferqfd_saferrrrpl_mbrtowc#stopenat_proc_name8nw4save_cwdrestore_cwdfree_cwdxrpl_strndupyvasnprintf~Drpl_wcrtomb—xgetcwdVprintf_frexp hprintf_frexplchdir_longPUIrpl_getcwdrpl_isnanll>memrchr#| printf_fetchargsprintf_parse__umoddi3p8  j+j$kDm:mpqJrrsInwxEy91~e—&] P" ^ll|  z}-  U ,} -  U ,} U  U ,} [awrtflFidfvFFAl`t?S|iu|lu|P    % * 5 J~U"22u*~zH[Obr$#6#6/Sbq<O:u; k  4 q  l k {+uk ; 4   q l k 8{+0Huk ; Z   q ^ l . R #k qv+027LLN|!ci  2 9   64 o ~Y ~`c@ ` e T [ _|,v;BD^|*^8UQTV\ItI~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O()9D_]HKZ]LWz }"xKHdxT #0~T #0< m0#< mX#1u 5< AuFy0/"0*.w GNU C 3.4.3 (csl-sol210-3_4-20050802)chcon.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntpad_ptr_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned int__longlong_tlong long intblksize_toff_tptrdiff_tshort intshort unsigned intu_longlong_tulong_tino_tblkcnt_tlong doublemode_tuid_tgid_tdev_tnlink_ttime_ttimespectv_sectv_nsectimestruc_toptioncommand_namehas_argnostatst_devst_pad1st_inost_modest_nlinkst_uidst_gidst_rdevst_pad2st_sizest_atimst_mtimst_ctimst_blksizest_blocksst_fstypest_pad4get_root_dev_inocontext_tI_ringir_datair_default_valir_frontir_backir_empty_Boolmbstatehash_tablecycle_check_statefts_curfts_childfts_arrayfts_devfts_pathfts_rfdfts_cwd_fdfts_pathlenfts_nitemsfts_comparfts_optionsfts_leaf_optimization_works_htfts_cyclefts_fd_ring_ftsentfts_parentfts_linkfts_numberfts_pointerfts_accpathfts_errnofts_symfdfts_ftsfts_levelfts_namelenfts_n_dirs_remainingfts_infofts_flagsfts_instrfts_statpfts_nameFTSENTusageproc_statusemit_bug_reporting_addressmainargcargvref_contextbit_flagsdereferencepreserve_rootcomponent_specifiedreference_fileoptcnew_contextdev_ino_bufcontext_newlgetfileconprocess_filesprocess_filefile_full_nameproc_filefile_statschange_file_contextcontext_stringprint_errorsprev_failcompute_context_from_masksaved_errno__iobrpl_optargrpl_optindoerrnoVersionexit_failureset_program_nameaffect_symlink_referentrecurseverbosespecified_contextspecified_userspecified_rolespecified_rangespecified_typelong_optionsversion.cprogname.c/opt/pkgs/coreutils-7.4/libargv0find_non_slashversion-etc.c__gnuc_va_listversion_etc_vadirstreampackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cbasename.clast_componentsaw_slashbase_lenprefix_lenbase_nametmp_lengthcloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineexitfail.cxfts.cchdir_countergl_uintmax_tdirentuse_d_inod_offd_reclendd_fddd_locdd_sizedd_bufa_floatHash_tableActive_dirfts_entLCO_entopt_okAD_compareAD_hashtable_sizeleave_dirpfoundfd_ring_clearfts_set_stat_requiredcwd_advance_fdchdir_down_oneprev_fd_in_slotfts_lfreebucket_headfts_allocfts_closefreepfree_dirLCO_hashLCO_comparefts_setfts_compare_inofts_statfollowfts_pallocmorenew_lenfts_sortdummyxfts_opendefer_statmem1mem2mem3fts_maxarglensetup_dirdiropenopen_flagsfts_safe_changediris_dotdotnewfdbailparent_fdfts_builddtypedirpoldaddrdescenddoadjustnlinksmaxlendir_fdis_dirskip_statopendiratnew_fdset_stat_typefts_padjustfts_childrenfts_readcheck_for_dirhash_get_nextenter_dirad_from_tablelink_count_optimize_okfts_loadgetopt.cREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optopt__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptexchangebottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlynameendexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalproc_resultrpl_getoptgetopt1.crpl_getopt_longopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardhash.cHash_hasherHash_comparatorHash_data_freerHash_processorhash_entryhash_tuningshrink_thresholdshrink_factorgrowth_thresholdgrowth_factoris_n_bucketsHash_tuningnew_bucketbucket_limithash_get_n_buckets_usedhash_get_n_entriesfree_entry_listhash_get_n_bucketsnew_tablehash_get_max_bucket_lengthcursorhash_table_okhash_print_statisticshash_lookupnew_entryhash_get_firsthash_get_entriesquotearg_bufferbuffer_sizehash_do_for_eachprocessor_datahash_stringa_string_valuehash_reset_tuningcheck_tuningepsilonhash_initializenew_candidatenext_primeis_primedivisorsquarehash_clearhash_freeallocate_entryfree_entryhash_find_entryhash_deletehash_rehashhash_insertdefault_tuningi-ring.ci_ring_initi_ring_emptyi_ring_pushdest_idxold_vali_ring_poptop_valopen-safer.copen_saferquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftset_quoting_flagsquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimbytesleftquotearg_alloc_membufsizexcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_vals__ctypedefault_quoting_optionsslot0nslotsslotvec0root-dev-ino.croot_d_istatbufselinux-at.csaved_cwddesclgetfileconatproc_errnolsetfileconatlsetfileconvfprintf.crpl_vfprintfformatoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupinvalid_argfseterr.cfseterropenat-die.copenat_save_failopenat_restore_failxalloc-die.cxalloc_diexstrndup.cxstrndupclose-stream.cclose_streamsome_pendingfclose_failcycle-check.ccycle_check_initcycle_check__func__is_zero_or_power_of_twodup-safer.cdup_saferfd-safer.cfd_safermbrtowc.crpl_mbrtowcinternal_stateretcountopenat-proc.copenat_proc_nameproc_self_fdproc_self_fd_dotdot_stproc_self_stdotdot_bufsave-cwd.csave_cwdrestore_cwdfree_cwdrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerargumentargumentsdir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charmount_pointpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memoryoverflowbuf_neededlengthbuf_malloceda_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharacterstmpbuf__x_ntmp_memsizesign_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombxgetcwd.cxgetcwdprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_ichdir-long.cuint_tcd_bufcdb_advance_fdcdb_freechdir_longFailn_leading_slashcdb_initcdb_fchdirrpl_getcwdfd_needs_closingrootdevthisdevrootinothisinomemory_exhausteddotdevdotinoparent_statusdirroomnamlenmatchentry_statusoldsizesaveisnanl.cmemory_doublerpl_isnanlmemrchr.cmemrchrc_inlongwordchar_ptrlongword_ptrrepeated_onerepeated_clongword1printf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3/gcc/libgcc2.c/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3-i386-build/gccUSItypeUDItypeDWstructhighDWunion__umoddi3__udivmoddi4__cbtmp.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.1.rodata.str1.4.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo  `V' l l /",,7o,+,+Eo++Rot-t-c ,0,0@o Bl0l0 st2t2 x66~( 2((2  ,$$X|  lxx || !' `/E-N 86/FeR[9^R"kxuR {ʁJ0 0707011d719ccd000081ed0000000000000000000000014a5bb2cb0002bac00000012e00000002ffffffffffffffff0000001900000000root/opt/aosug/bin/chgrpELF644 (,+44o   LLX/usr/lib/ld.so.1 !#$%&'()+,-/035789:;=>ABCEFHIKLMNPQSTWY[^`bcdghjlmrtuvxz|}  "*.1246<?@DGJORUVXZ\]_aefiknopqswy{~  +7 A7 MUblw O ,QL xQ  Q lRI R1 RY "HS& ,pS| 6U ? U K\U@ [UO dVx odW x[ ^n dp 0 ȅ/   &T2 A, O" hpQ {- .  '2<I1 \fu  43 \E HKj 65#5 BȔ ID Q̠E ]N` g't3v5}6   T6d33( 8 L5Ć@ \d D5 65p XJ 058 It6"ai  w 0@ (~#  5 }! M'  x 3d. )d6/45d5>ȗD P~& _ j@wd4~  D3Q 5L ! 0 33`     = "  *0J 9pL G N a7 i` wH1  $T5T  4- lP 4 ] 2Tm Pe f "3+272>M KD4R J% r(: w xN 44246T}b Pk + @5 $5) Ğ 62S# K^     / 4: > E PD V >: b /x t?  @  L$ 45 4 5 ^ 4! 5 M     t~  4$ . / L~& C X , l3`  o Ė z ؓG 4U' 4)  1 ' 7~  $4 T3 . h2 `N  t4 t5   MF  # T4+ 4MZ F  P D [ g d 4n R x  5  D6 3 %   }# $2 lL   44  " `8 ( 3. >, 9 U 0$ 3 g  y d2 ԋ\ , 3  $X 3 2 4 ( 4 m $3 4  z T2 Tq   8?: # D2y$6- lN  chgrpfsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummychgrp.cchown-core.cversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cerror.cerror_tailexitfail.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt1.chard-locale.chash.ccheck_tuningallocate_entryfree_entryhash_find_entryi-ring.copen-safer.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.cstpcpy.cumaxtostr.cvfprintf.cxmalloc.cxstrtoul.cbkm_scalebkm_scale_by_powerfseterr.cxalloc-die.cxstrndup.cclose-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.sendgrentget_quoting_styleclone_quoting_optionsset_program_namestrnlenfclose__longdouble_usedquotearg_memquotearg_allocrpl_strndupbase_name__environ_lockfwrite_startcycle_checkdup_saferprintf_frexpstrcpyopenat64quotearg_colonprintf_fetchargsgetenvhash_rehashhash_lookupxcallocquotearg_freesprintf__fpendingget_root_dev_inostrncmp__fsr_init_value_get_exit_frame_monitorVersionquotearg_char__umoddi3hash_get_max_bucket_lengthrpl_getopt_long_onlyquoting_style_valsmemcpy_endrpl_getoptbase_len__1cG__CrunMdo_exit_code6F_v_xfts_openfstat64quotearg_n_style_memldexpqsortiswprintquotearg_char_mem_getopt_long_rrpl_opterr_lib_versionfchdir_environquotearg_alloc_memgetgrgidhash_do_for_eachrpl_mbrtowc_DYNAMIC__ctype_Jv_RegisterClasseshash_get_firstfstatat64i_ring_emptyprintf_parsex2reallocfseterr_finifd_saferhash_table_okstpcpyerror_one_per_line_mcounthash_get_nextvasnprintfquoting_style_argsopen64errnohash_delete__deregister_frame_info_basesquotearg_n_styleerror_at_linexstrndupgettextclose_streamrpl_wcrtombfts_childrenfchownatfputsrpl_vfprintfhash_insertxmalloc_GLOBAL_OFFSET_TABLE_bindtextdomainquotearg_styleclose_stdoutxreallocatexitwcslen_getopt_internalerrorxalloc_diexstrtoulstrchrcycle_check_initfts_closeversion_etc_vaquotearg_style_memhash_print_statisticsstrerror_rchopt_freehash_get_entriesgid_to_nameversion_etc_copyrightchown_filesquotearg_colon_memerror_message_countxzallocxstrdupfflush__assert_c99rpl_isnanldirfdfcntlversion_etcrpl_optindhash_get_n_bucketshard_localelstat64open_safer_getopt_long_only_rerror_print_prognamequote_nquotearg_n_memquotearg_nquotearg_bufferfts_seti_ring_init__fsrrpl_optopt__flsbufgetpwuidhash_string_etextclose_stdout_set_file_namememsetmbsinitquotearglast_component__dso_handlememmoveemit_bug_reporting_address__udivdi3i_ring_popfts_readreaddir64umaxtostrrpl_optarg__iobprintf_frexplwctombstrrchrxmemduphash_get_n_buckets_used___Argvrpl_getopt_long_PROCEDURE_LINKAGE_TABLE_i_ring_pushexit_failurestrcmphash_freeusageabortchopt_init__register_frame_info_basesset_quoting_flagshash_reset_tuning_exitset_char_quotinghash_clearfchown_edatasetlocalefdopendirhash_get_n_entriesclosedirhash_initializegetgrnamset_quoting_style_getopt_internal_ruid_to_name__fpstartclose_stdout_set_ignore_EPIPElibc.so.1SUNW_1.23SUNW_1.22SUNW_1.21SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/libK yU y_ yi ys '= } (=  qN  7                                   d+X`. !"#%* } #|o)%*+,n ^WV(123]q4\zjut;<ef_Hk{~a [yl/#<VDLBT,j048@VHPBT[Xs\a``dhlptx|=1E_Dxc:i4"pS5 + $(?,048k<@D3H$5$%(%,h%0h%4h%8h%@h %Hh(%Ph0%Th8p%Xh@`%\hHP%`hP@%dhX0%hh` %lhh%php%thx%xh%|h%h%h%h%h%h%hp%h`%hP%h@%h0%h %h%h%h%h%h%h%h%h %h(%h0%h8p%h@`%hHP%hP@%hX0%h` %hh%hp%hx%h%h%h%h%h% h%h%hp%h`%hP% h@%$h0%(h %,h%0h%4h%8h%<h%@h%Dh%Hh jjLt Rhtt PmEu TRU RPO"$ PPFNURQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[wRt :ҋu鋃t Pƃ]ÐUS[P$tSjPPWt,t PA]USP]t,P5LPhD&ZYPh) SQ5L5Lhl$ XZhh$YXhh$XZhh$YXhh`$XZhhx$YXhh`_$XZhhF$n 5L5Lh%$= h9Q5LYZPhO$ hjhfhP$XZhh$$D 5LZYPh$dUWVSu 6]ƅDžYXh8j~XZhthj}$j$xNEȉ$- jh`hVS"C t^cYHVjPaL jh`hVSDžB u}؋ HE)ЅF98PQ \SmE'=hMfE=|A= HREvEƅEtDžeZDžKƅ?189T h# Pjjr jH~΍B;u1E܀;ujE̊PEPjjSjPwUȈR1$:Dž Sxu=}F=~1 j h<ZEL hMPh  P5jJOt$1o tpMPh h, Pjj1. 5H-MPh | P5j? h84Pj jS\ t* SLPh) Pjjx4$Pjhh5hfhhRjD$@@ @@ @@ÍvUS0]S8ZtP[]ÃEP1RSY݉US0]S YtPc[]ÃEP1RSOY݉UWVS}E 1Qj Pu] "(H@A8ۋR ƅƅw$0M yv}bU B @tA%=01t}9]9Y 'vt-fS8Bfff] { }ZDž@A%==@$\C,u C LE x |ƅƅDž] ]!؊1Ʌ}]9X Džt&DžtU ZrDž|Cۉt_tY1йщtt QrW_ZV SP|KVf:@P|M8 hXv WQH_ZPS^|] {à $t] { 1ۃ e[^_Ã}t]9X$UO] {ovSjPE x&ZJW11 G9ghj6GPj"GPhx Pjj hl Pjj 1 h2M y  FPh PsjN E x  oFPh Pr붋] {&{t-XTHPW11 uG9B@ƅM y  E}Ph P5jW PhS@PW<Dž Wƅƅ4 juurq }!U z M 9v}M A v}tM9J$( h huup -=z ƅƅ } CY[Ph0:$RYM 9h] C jXSp)tU z  ƅ h4 hO hh= XH11 9}tM9}t]9jVuuWLDžH WƒH jBPhkA ]3P1~,ofFF@UB oE4UB(U~ jSE22؃4C(u jSF0F$@QP]SEpHXZj/St+9XB1WQRYu^0UBFF@X(UBE)UB]1C) DGf8fG8F@PUr016} jEfF8fHfF<YVhjE NEH( C w <E{EX(d%RPhUrF fN: v r v ^]K( ]s0 NK( fV8QEPPhTPhsc V11 NfF8<GfG8 ht3h UhUjj  1҅G,E j/1҅@C@Wut19e W1UWVS T$ƋB D$D$D$R$9Љ$D$D$~\D$9‰~RT$,$+$+l$9T$~`19}'D$)D$ L$T$ G9|)l$$9D$YD$+$D$T$B D$B$ [^_]Ív1L$$G;|$|T$$T$9D$~T$9JUWVSlE$@EU::rUҸQM$A FE$X$X u@E }$1ۅDU$ZM<-X<+ 1U$BM$uA}$}t ?XE$U$@$9؉E~]Z$M$A 9~؉Y }$;]U 4u7U}$9W C9tE }E$U}x$;]H} :-M$yt CQ e[^_ÐAE$X$X u@E 1ۅ hU$ZM<-FBBiu1Ʌt<-u| E$x}]5U$M B<-tMz}EEEE}t<=t EUuuEM+MMԍvPuu6u>>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃Pu脿EM$@A}VuZuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7WhZYPhU$?r뵋Et)M x-t}Pu EtBU x-+ U$rPM 1Sh\aZYPhd }$E$U$@8C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2Ph|@^_PhCUȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1Qh蛷_ZPh螷}$ }1}ыELU$JMA B?C}]ȉ}EE t0Sh*ZYPh-U$RUCVE 0ShZYPhcut$E t0Sh˶ZYPhζM$Q׊EэLE$HU::M 41Sh~ZYPh聶}$GE!VE 0ShMZYPhPN]M$Q1ыE$LH?}71Wh[^PhE$@ESuuTE$P1ыE$LH?}7E 0QhL菵_ZPh蒵MM$} 47Sh|bZYPheUh`u uuuuu u` d`l h ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuV\tw P藶tehV0tSPot(hV tSPIu1SV$le[^_ËD$@ËD$@ ËD$@VSD$ X19v*vtAB@u9v։9w[^WVS|$_119vtFABvA@u9w9w t1[^_9Ot1UWVS u[[u@Yu=ZuBWhu E赲 Vh5u 褲1҉$S,$1҃RV,$ $Shu vuhMu ce[^_UWVSu} vWVƒ9Fv<1҅t3WVu[u1ҍe[^_Ëe[^_UMQ1tIv9vtIJUVS]su VS‹K9v7Ѕt90t"@vu 9r1e[^É@tڋdUWVSD$p19ދl$|$v"t9sRDAu9w[^_]UWVS E0@19v0t"u3U t[GuUB9wэe[^_ÍvVSL$ t$1)1Au[^ÉWV|$ ^_ÉPBEuEt1AÉB Euu+BEuuEuÍvUWVS,}] M j(\ƃ1*^'{u?1ҋERP,$sكtn}fE fEm}mEE}wKM vY 9Es1҉uԅtEԋEԍ@9ˉEr1҉uԅu.؃ Ve[^1_ù 렻.Nw΃jQ]‰tF‰FEFEF F F~F$e[^_ÍvUWVS }7G9vzvtj^O SG$҉C_$t,t 3ыSG$҉C_$O u׍vu-FG9wG Ge[^_à 6уNjO 뾉UWVS EP ҉Ex8@9vh7t#t 3MQ [uUB9wЋM9v-v_t sSuUB9w֋MY$ sSu E0έUUe[^_鹭E@낍vU@$t ‹@A$ɉÐ jVƒÐH$JP$UWVSƊE EvRVƒ9^E1t&RWVt4};t KuIe[^_É0WVu[Cue[^1_ËS}:tŋBC QSʉ>UWVSEp pppu ǃ 1UB$G$EB;EvUtqv;]FC^]tKwPEW4ƒ9wSɉUuUG ;]tډ}]uUBE;Ey E0ЫUGBGBG B G$B$<$詫e[^_ÉtEFBV7贫1UVS] ۋu%jEPډt e[^ÉEu;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]suޟUSPMɋU t1 APq1uuE ]ÍvȐUWVS}MWɉEUtk GPu7u 1҉Eu1MÃCSEBZuu7u uډ&EU tUEe[^_ÐU덿nUuju uBÐUVS;5 s tlC;rF=t PMt V% e[^ÍvUWVSƅUE #95wyVEUE}PP }ã tS=M)1<EE UP|PRE؋E 0uUuUi 9EwI@Et W  u?_Duu܋U 2uuU E죸e[^_É1GvUhEU jÍvUhuEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<} EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUShPh]1҅ux|hSCډЋ]L$T$ABuAUWVS E]u x@vjj VSH0Ojj VSFÉЃ ؉uԍe[^_UWVSuu PP}DžƋtRWSjP)9rۉx1e[^_Í9t VO WPUS]S|t]Åt+vUS ] Su衚t]ÐtvUSR]M ۋtsB‰U ]X[u@vUS]S\ SjP ]Uu uÚtyUS] S SuP]ÍvUW U1QR}Sщ1Ҹ9s[Ívщ1[ÍvUWVSQ1]E E KuZ[^_ÉUWVS]$uE} B u-PSWV9Et"EuEPu*ttj0utCDtIBt>B5wA$lh`jShkh^} }E봋EUEe[^_úECU E8tMEUEe[^_ËEPu9tvEi'{BEjE[njjj1]Ijjjjú/e[^_UVS]PuE PS蓺t e[^Ð1҅tK8uut7 h8wPhuƔ Pjje[^ D$H Uh茔PhjPұ聕Uu utUVSuV_E^ 4$]ut+}u = tu e[^Ée[1^D$@ @@ÉUWVS ExthDj0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt  Ju0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 -3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @hLt Lgh uYh|1XDE |nKI;w0CJu + xj 1ۃ؃w ICNCFC? <h2 < h) P.g.Dq(L؉,!8Q8@Vi0CutbC0COuDA$C+C0C0CKI;w CJuNAAAN<ٽnfnffl٭l۽-CEE@uv؋DB$A<ICNCFCffj٭j  ٍxP <$+E@DB$E 21 EEEsEEc E %E EF9sE_;UlURU> P!V PCU u0UEEG E.EE E PUEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt PS AURU PSUWV T$(t$|$ D$$҉t$ʼn$u9vGD$ 1^_]Ív9<$v1v$ǃuA;4$w19l$r̹Őu 11ʼn1NjD$ ^_]ø )D$$L$ ‰$L$D$L$ Ɖ4$d$9wB;D$8I2UWV(D$@T$DL$ ƅҋD$. write errorUnknown system error%s: %s:%d: %s:..--POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous state->magic == CC_MAGICPOSIX# entries: %lu # buckets: %lu max bucket length: %lu "'`xstrtol.cinvalid argument: %smemory exhaustedcycle-check.c%#.0f%+d(NULL)recursivechangesno-dereferenceno-preserve-rootquietsilentverbosehelpversionliteralshellshell-alwaysc-maybeescapeclocale7.4Try `%s --help' for more information. Usage: %s [OPTION]... GROUP FILE... or: %s [OPTION]... --reference=RFILE FILE... Change the group of each FILE to GROUP. With --reference, change the group of each FILE to that of RFILE. -c, --changes like verbose but report only when a change is made --dereference affect the referent of each symbolic link (this is the default), rather than the symbolic link itself -h, --no-dereference affect each symbolic link instead of any referenced file (useful only on systems that can change the ownership of a symlink) --no-preserve-root do not treat `/' specially (the default) --preserve-root fail to operate recursively on `/' -f, --silent, --quiet suppress most error messages --reference=RFILE use RFILE's group rather than specifying a GROUP value -R, --recursive operate on files and directories recursively -v, --verbose output a diagnostic for every file processed The following options modify how a hierarchy is traversed when the -R option is also specified. If more than one is specified, only the final one takes effect. -H if a command line argument is a symbolic link to a directory, traverse it -L traverse every symbolic link to a directory encountered -P do not traverse any symbolic links (default) --help display this help and exit --version output version information and exit Examples: %s staff /u Change the group of /u to "staff". %s -hR staff /u Change the group of /u and subfiles to "staff". %s home page: General help using GNU software: Report %s translation bugs to failed to get attributes of %s-R --dereference requires either -H or -Lchanged ownership of %s to %s it is dangerous to operate recursively on %s (same as %s)use --no-preserve-root to override this failsafeownership of %s retained as %s failed to change ownership of %s to %s neither symbolic link %s nor referent has been changed failed to change group of %s to %s it is dangerous to operate recursively on %sfailed to change ownership of %s License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous # buckets used: %lu (%.2f%%) 0 <= strtol_base && strtol_base <= 36B=fff?̌?OO?A=@??L:2J2Z2j2z222222222 33*3:3J3Z3j3z333333333 44*4:4J4Z4j4z444444444 55*5:5J5Z5j5z555555555 66*6:6J6Z6j6z6K     H  ````-`oBo*o(//ho`o`` t6@?zR|0 L  zR|0 L 8t 0H *\+- / / $2 6 @8D L$$$,4   !"#$%&'()*+  *=R ]dp{ @$$,4  7 $7 &.`;< IHXeozPT O X \*0,QL ;xQ  CQ MlRI [R1 qRY HS& pS| U  U \U@ UO Vx dW [ ^n dp `()0?0 Lȅ/ [ f v (T2 , " pQ *9BNYcn- x. ` )D 1 '1@PYgpz  (0 43 \E )HKj :6B5I[ hȔ D w̠E N` t356   T6d33( 8 -L5Ć@ \d D5$ 26:5p EXJ V5^ ot6"   0@ (~#  5 }! M'  (x 23:d. Od6U4[d5dȗD v~&  @d4  D3Q 5L ! 0  3C3$ `  1   > = H   P V J _ pL m  t  7 ` H1 $ T5  T 4-  lP  4 ]  2" Tm / Pe ; f H 3Q 2] 2d M q D4x p % (:  xN 4 42 46 T}b Pk + @5 $5 )  Ğ \ 2 S#  K^ ,  ?  U 4` > k PD | >: / t?  @  L$ 45 4 5 ^ 4! 5 M   #  6 t~ B 4J . U L~& i ~ , 3  Ė ؓG 4U' 4)  W  ' 7~  $4 T3 .  2`N  t4 t5   MF ! . T46 4MZ Q  [ D f g o 4y R   5  D6 3 %   }# $2 lL 44# -`8 339>, D `0$ >r d2ԋ\ , 3  )$X 3324( 4m $34 T2Tq  "8?: .D2 $6lN  chgrpfsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummychgrp.clong_optionsdev_ino_buf.0reference_filechown-core.cversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1exitfail.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt_datagetopt1.chard-locale.chash.cdefault_tuningcheck_tuningallocate_entryfree_entryhash_find_entryi-ring.copen-safer.cquote.cquotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.cstpcpy.cumaxtostr.cvfprintf.cxmalloc.cxstrtoul.cbkm_scalebkm_scale_by_power__func__.0fseterr.cxalloc-die.cxstrndup.cclose-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.cinternal_state.0vasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cwide_null_string.0printf-parse.clibgcc2.c.LFB3__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START_endgrentget_quoting_styleclone_quoting_optionsset_program_namestrnlenfclose__longdouble_usedquotearg_memquotearg_allocrpl_strndupbase_name__environ_lockfwrite_startcycle_checkdup_saferprintf_frexpstrcpyopenat64quotearg_colonprintf_fetchargsgetenvhash_rehashhash_lookupxcallocquotearg_freesprintf__fpendingget_root_dev_inostrncmp__fsr_init_value_get_exit_frame_monitorVersionquotearg_char__umoddi3hash_get_max_bucket_lengthrpl_getopt_long_onlyquoting_style_valsmemcpy_endrpl_getoptbase_len__1cG__CrunMdo_exit_code6F_v_xfts_openfstat64quotearg_n_style_memldexpqsortiswprintquotearg_char_mem_getopt_long_rrpl_opterr_lib_versionfchdir_environquotearg_alloc_memgetgrgidhash_do_for_eachrpl_mbrtowc_DYNAMIC__ctype_Jv_RegisterClasseshash_get_firstfstatat64i_ring_emptyprintf_parsex2reallocfseterr_finifd_saferhash_table_okstpcpyerror_one_per_line_mcounthash_get_nextvasnprintfquoting_style_argsopen64errnohash_delete__deregister_frame_info_basesquotearg_n_styleerror_at_linexstrndupgettextclose_streamrpl_wcrtombfts_childrenfchownatfputsrpl_vfprintfhash_insertxmalloc_GLOBAL_OFFSET_TABLE_bindtextdomainquotearg_styleclose_stdoutxreallocatexitwcslen_getopt_internalerrorxalloc_diexstrtoulstrchrcycle_check_initfts_closeversion_etc_vaquotearg_style_memhash_print_statisticsstrerror_rchopt_freehash_get_entriesgid_to_nameversion_etc_copyrightchown_filesquotearg_colon_memerror_message_countxzallocxstrdupfflush__assert_c99rpl_isnanldirfdfcntlversion_etcrpl_optindhash_get_n_bucketshard_localelstat64open_safer_getopt_long_only_rerror_print_prognamequote_nquotearg_n_memquotearg_nquotearg_bufferfts_seti_ring_init__fsrrpl_optopt__flsbufgetpwuidhash_string_etextmemsetmbsinitquotearglast_component__dso_handlememmoveemit_bug_reporting_address__udivdi3i_ring_popfts_readreaddir64umaxtostrrpl_optarg__iobprintf_frexplwctombstrrchrxmemduphash_get_n_buckets_used___Argvrpl_getopt_long_PROCEDURE_LINKAGE_TABLE_i_ring_pushexit_failurestrcmphash_freeusageabortchopt_init__register_frame_info_basesset_quoting_flagshash_reset_tuning_exitset_char_quotinghash_clearfchown_edatasetlocalefdopendirhash_get_n_entriesclosedirhash_initializegetgrnamset_quoting_style_getopt_internal_ruid_to_name__fpstart@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I : ;I I !I/ : ; I8 &I : ;I8  : ; ( .? : ; ' @ : ; I 1.: ;' .? : ; ' I@ 4: ; I 4: ; I  U4: ;I 11 U41    .: ; ' I !: ; I"4: ; I# $4: ; I? < %5I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  : ;I : ;I8 I !I/  : ; (  : ;  : ; I : ; I<  : ; ' II&I: ; I.? : ; ' @ : ; I .? : ; ' I@ : ; I 4: ; I .? : ;' I@ : ;I : ;I !4: ;I "4: ;I # U$1%1& U'41 (41)1*1 + ,.: ; ' I -: ; I.: ; I/4: ; I04: ;I14: ;I2 3 44: ; I5.: ; ' 64: ; I? < 75I% 4: ; I?   I&I$ > % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% : ; I$ > $ >  I : ;I : ; : ; I8 : ;I8 I !I/  : ;  : ; I : ; I<  : ; ' II&I: ; I& : ; I8  : ;.: ; ' I@ : ; I 4: ; I: ; I .: ; ' @ 4: ; I  U 4: ; I ! ".: ;' @ #: ;I $4: ;I %: ;I &4: ;I '.: ;' I@ (.? : ;' I@ )1*1+.: ; ' ,: ; I-4: ;I. : ;/4: ;I0 U1 : ;21 341 415.: ;' I 6: ;I7.: ; ' I 8 9: ;I: ;41< =.: ;' >4: ; I?4: ; I? < % $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  ' I I & ' &I.? : ; ' I@ : ; I 4: ; I  .? : ; ' @ 4: ; I.? : ;' I@ : ;I 4: ;I 4: ;I .? : ;' @ .: ;' I@  : ; 11 1 41 !.: ;' I ": ;I#4: ;I$ U%.: ;' @ & U% $ >  : ;  : ; I8 I!I/ $ > : ; I .? : ; ' @ : ; I : ; I 4: ; I  I.? : ; ' I@ &I4: ; I .? : ; ' I@ % $ > $ > : ; I: ;I I.? : ; ' I@ : ; I  4: ; I  4: ; I &I% $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' I@ : ; I 4: ; I  I% $ > .? : ; ' I@ : ; I : ; I 4: ; I  I&I% $ > $ >  I: ;I.? : ; ' I@ : ; I 4: ; I % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > $ >  I&I : ; ( : ; I .: ; ' I@ : ; I : ; I 4: ; I .? : ; ' I@ 4: ; I 4I4    UI!I/ !4: ; I? < % $ > $ > : ; I I : ;I : ; : ; I8 I !I/ : ;I8  : ;  : ; I : ; I<  : ; ' II&I: ; I.? : ; ' I@ : ; I 4: ; I  U4: ; I % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' @ : ; I  I.? : ; ' I@ : ; I 4I4  11&I.: ; ' I : ; I% $ > $ > .? : ; ' I@ : ; I % $ > $ > .? : ; ' I@ : ; I  U4: ; I 4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < % $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 11 U4141  U .: ;' I : ;I4: ;I 4: ;I  I&I% $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 4: ;I 111  U4141  .: ;' I : ;I4: ;I 4: ;I  I&I#>`8'/MR *7R *Y 8#_ 9#j ;#p <# v =# } ?#  @ #  A #  B #  C #  D # intK  D'ED4ea%<VBKK(U  ash hx n{ th zh ( ; <# =(# Sb 0 1s# 2s# 3# 4b# s x( /  # #q # val #  %# #y## #)# 0#$7#(?#,G#4O#<W#D_#Lg #Tr #X| #`h#p ( / ( / % /0  y# #O ,.0#1#5#8# ;# >s#As#h`8':U gS88'n2B(:>UGSLbVQ~gidS_~iWuOHokS{P~ #sS2<<C@NW`ZPl==*<A>>f~ tP!O"gidQ#"grpUt#"tmpZa , /;$z$ rs$ $:$$%$ /sH   / ;!` rOFK>/MR*7R*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # int KN c  G D'EZ4ew% <lBaK>U  as~ hx n{ t~ z~ >* ; <# =># S$01#2#$3#+4# 25#96#D7#M8#T9# 01#2#3#4#    #  # # #  #) # 0 #$7 #(? #,G (#4 O *#< W *#D _ *#L g #T r #X | -#`  =#p > E -> E =% E M> E d% E  # #]kz @,.#1@#5G#8@# ;@# >#A#d  !#"###$#%@#  E'MhtTE# F#G#!H# )I#2J#:K#EM#QN# \O#$g#(s#,#0#4E###># ##)### E#$#(3#, #0#4.S#87S#:AS#<K#@UT#FTS /  E^ee'pv;>>Tu:PG>>TuFR>6?UgidQSbufSXgrpT P % ET `8?r?Uuid_SbufaXpwdbT P5 @t?FKU_P uid gidu  !ok@S"R!fts}#` x!ent }$ ??% % % % % % %" &'- }'8 }'C }'N ~'Y }'d }'p }# ( ) @$A* S% % % % % % &' }'* }(4 '? W&X( &' })W AB%d %o *z S* V&' S' W' |+u EF'J S$ 4FVF% % % % ) FG%% %%  /, @-fts-ent -uid-gid...u /" / /1 /< 0ok@1E@1N@2 0err:31V@31 %  ,W ^:.>. .o -uid-gid../ :4st /w4fd3/5 o.m .Vm.n .n 4fmtp /q /r, j-fdi.i .i.i,,p-fdo.o .o.o <, E;6 ,6:6c76 FHKHK/7=BMKHKj#HKKU"jS)jk*jppuM jL^MK +06MU%R*S R*Y8 #_9#j;#p<# v=# }? # @  # A  # B  # C  # D  # intT[HNc  U  +KMU .(p )Q 5)l @*W J*= H,9S KK R0=R.6 f^M4MU .  5 @J='4MMUHK;yjrMMMint U O.%jy0A`NMintNP7!MMT k"Pp#Q$S M  p,MMToRlenq,P r, KN`NUJVkLSM,P-w O`NMR*7R*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # int U  o*`NjNT )oPu % OlNvNT  N  lxN OU @ - poP:,;  = $oP .TuW+Q OG  +06MU%R*S R*Y8 #_9#j;#p<# v=# }? # @  # A  # B  # C  # D  # int 6U  O  OPU  W Z  V m  = OO XR w6a j Z i sk n(65vPkPU   Z   m  = lP+QU  Z   = S  Vm  =p9 X  \ 7#  :      ^H5; N aX  ,Q,Q intM U %D  bp,Q G0intNPBM Dl'Ez4e^<BKIU ashxBn{tzIU ;  < #  =I# S,b  #  b#  #  #  # ) # 0 #$ 7 #( ? r#, G #4 O U#< W U#D _ U#L g #T r #X | #`  #p rI P I P ^ P I P  !#  "0#  #B#  $B#  %# 0 P ' 5ht;x5x {# # w 0#AKT Ec# Fc# Gi# !H# )I# 2J0# :K0# EM7# QN7# \O#$ g0#( s;#, #0  #4cE c# c# c# I# # # )# 0# 0# E7#$ Ŧ#( %#, 7#0 #4 .s#8 7s#: As#< K#@ U#Kc0KoFTS~ ` P ^ P^K  z/  -  .# ! /# ' 0s#  1#p : 0 60# 6 70# = 80# E 9# DIR :/   #  #N T 85_ dev#ino# j # &r  # z #k !,QxQTx Uy Wax"kay#kq *7xQQUx)P )7 ax+k/ ~QkRUfts}Tent}Wst/V  P!RXX2PR03\P3hS4 uYY*);ZaZ**!;ZaZ3P '0''-35u 76L~-len7-max77 3,fts285 l09spk9dirk /wm0' 0[^U%sp~%p~%fd0%dir S$ret0V& ~& 0~1 ]:\]$sb`~4|]]**03P&0S!a^^& 0P' ^fU%spp# 0l$dph$pV& d&U7`$cur\&U X&%  T&* P&0S&2 O&: N&%H&C D&C$len7&J 7& 7R$cp1 Q^d4W=_v_*$*/03;V3GWo0&Q 0SX&X @P!aa/_ )baa*p*{!aa;4bhb**!bhb3R3S03TSp5bi 7 9fd609dir6 /s 80/% 9  P\5 9p--sp-h-tmp-ent/z -t2=  /9sp.9p.-len07-cp1?:0z B}dp intM OU R*JR*Y8%#_9J#j;J#p%T}}UG;%L;  ; < < =%v =% ]?%PdX%}}UGW%LW  W  r#$A;%&Fr &U%&: Z% &E `%. d`@r~}ointM OU #%#q#val%# O% U     - (!%%#: &%#E '%#(r# P -%#^ 5r#i W#t [%# d%#  e%#$ y*%}}U G(% L( k( ) )r q3%~&~U G0% L0 k0 1 1 d2q  A%(~K~U G>% L> k? @ @J%L~r~U GG% LG kG H H dIqJt~+Mint U %t~U$9V&Wp'P ~ 2%S + ;2MR*7R*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # intT[,Nc  U fl         R   R R! #$R# %!#z+)7-z#H.z#V/z#g0z# u1#N 4'T 80(66!#77#x8#9# :#=B#D[#E#F# I!#$=Hv TvP| (TvP(0TvP:0pTvP7QVJd7P R pTvW7RVQ7P.\Uv. xpZDR\UvVTW7P7SZRUvQ7R (RPU'vST'V*7R+7PYiEPTCvPCYUDW FQG7SH7RReUcvc dR fWg7Vh7S'T'QxVSchR-%Y.TYW0TQBRz^)U BS[WPVREV 5z\_Qll T S!!" !," #5#=4 D],U\W^!V$d!S e!R OŅUp!W!S !V Y!ȅUQnew!R% hTPT!R sRÆUVTW  Ps!S!S&z RW& RW& # !# !!u 3ĆU2 2 4W5!p6!S 7!l&` 0IRhK!V$PPY!R RQUVTSRP!t& hP!Q$#B z\y RT2USTRRV!t$#B PH)4  !#"##%#$%#%#int',M U  14]T ir1R Q iP _&`iT ir%_P e,lT ir+1Q val+P-%R.V9U ir81S:Q*M int4ekU asr +:U H*U cHR P  ap# :z/Y, intp(p,DUn%p v{M 8&pDYU%p- hX\>intNP7IGIS!awQM U ( ,# % .7W( [1P# c4%# 8W# g7  r "s,#valt#^\Uo]e_%Sp` 'iPToh,9qԋTopspPPK|%ԋ0To{Rc{i{%Suc}Qp~V\%Qr%Pb%0TToQi%Rr%P t TT[PRo J0JUJSsPVJPPN,֓U@,argJ, SPc% Ni,len,SJ,YY Y1E9rBmzU!]cescPm,jYƍPt,RH(w>Dy,W)ڏj,RJVzJWT7zF,ؓU C C,R!argDJ D,!oEpGQeH%SrI,P ` ƔU!arg^J ^, "^!o_paWeb%pcd%le,S"bufg#mn$,%&n, SȔU!argQJ Q, !oR';mUsv;Vi7Sg(9pU!n%V!argJp , k e%l"n07sv;SXn1,hYg",`valWc%\!,P#nz$pĖU!n%P!argJRU!n%P!argJR ,U!argJ  4U!argJ , o 4aU!n%!sPR!argJoH (dU!n%!sPR!argJ ,oH =U!sP!argJ Q LǗU!sP!argJ , _ȗ U!argJ , !chPk   q &U!argJ!ch  (=U!argJJ @XU!argJ , Z Z J)#rUi"STbuf"rPp$rWAH u06MR*HR*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # intT[=NcU% 6U  S%U fp$W `$ $9 buf&&p g'nV len(.S n).pz 8S#!676K:cߚuintNP7M ZU ,ݙUn+,S p-P8 Up7Pn7,STG IUpFSpnFTQ Z4 k t ~ x R,pÃpnTs,n,QLpUsP,SZpUnY,sY, p[P+lUpk+sk,S1[t}ߚUs[RaZquintM OU O?' O0 T x/S Y/%Qk NfA>U x@p k@%W s@%S errBV DyM@uU sKV ptrKD dK%S valL L^Nrp pODW tmpPkl errQhZ`j qYR chZHQk%V%dPrZAJjHj_:%F x intNQ>M DE'Eo4eZp%v<BvK,U ashx>n{tz,U; < # =,#S, p, Ly # y# # # # )# 0#$ 7#( ?#, G#4 OU#< WU#D _U#L g #T r #X | #` `#p , L , L Z L  !# "%# #># $># % # % L' <htBN<H!T E9# F9# G?# !H# )I# 2J%# :K%# EM3# QN3# \Ok#$ g%#( sB#, #0 #49E 9# 9# 9# ,# # # )# %# %# E3#$ |#( ɤ#, 3#0 #4 .h#8 7h#: Ah#< K#@ U#!9Z%ZZ`f!EFTSTq w L Z L^! '|xUL%Sk%% `&Cfts(|V2 R2%228>uR7!MR*7R*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # intT[, U  rT fprP!3intM U !3U%B"S4intNP74SUn, s P M  b"TMR*7R*Y8#_9#j;#p<# v=# }?# @ # A # B # C # D # intT[, U  (:TU .9V ; <S =P :#ĞM intDO'Ed4ek<vBkK,U ashx]n{tz,7;<#=,#SD# D### #)# 0#$7#(?T#,G#4O7#<W7#D_7#Lg #Tr #X| d#`t#p T, % d, % t: % , %  d  # ## # w H# #,ĞޞT +P |4;|U :sb: DPq B  % :@&|i% #XM intU d"HUfd!H!# nM intU y'H Ufd&HWf*HVe+HS:H~!V$̠ intNP7IGIM U (,#%e. pC, ̠U pwcBp sBvV nB,S psBW  O  Y,l 0 wc\>p ret],P>|PB"%̠N?0intM ZU }̠UsVn% len%Snew}P Z"v%M +06MU%intNPZIGl6 U HZ  ( ,#H .cl 2         ' 5 F X d t ~        :X&  C`KaySb[cddHjeZqfl{gijL lmnKoHqsuwxy z{5}N 6aHl/ ]#a#Q _ O#arg_#/Z:,9 d-# n.# c/H# v0# 1# 2O# 3# 4# 5O# =66#$ 7O#(9p_C >O#dir?_# @O# AO# CZ B6EU.4h6=sHMUHsR `S =deXaeyZ]̥jXN DPxObufsxsxcpViOxdp_x]sxOxOxQvpP P!Rn*Ox+O@[!@[P-Oq-sS wcHwHwOwHwfbpsWZwx argHPJ`!J`" 6Oq6sS "!" CO  !  P HOqHsV 0Ow @ cMHNHxOOxPHxQOx. argYHP J ЧargyHPb R arg2 x3 x4 OSw< Ox C  bufJ ~K HP $ OV /  " 0  Oq sVy X ""!""!buf ~ HSp n5 OW 7N!7N" 6 Oq6 sSL v| "!"9  F wcH HwI HwJ OwK HL OWM OR!N +ytmpO sw(P swpQ sS OS S ɫnsOS m ٫nOS <.xN] !"# OqsS ٭߭ "!"Y HxHQJ OV L xcM HxN HxO OxP HxQ OWR OR!S +ytmpT sw(U swpV sS"@arg^ HP >karg~ HPVX R!Pįۯ!įۯPparg[ \!!%0] pad ORend sV!q sQ OS #n Og!"P Oq sW  D6 O1Bj H DJ$l %l %Gl _ml wM HxV ]_ HPYYٳk\!ݳ"vq argY HP argy HPô!ôPӴ!ӴP8arg\!040;padORendsV#nOy׵!׵"OqsW RĶQP +mo R0^QPKxQ Pc8argRx#nOdRdw!dwPOqsS 4{argyRSarg RST7argMZRTarglRS plargGHR argAZR arg;HR@U  \q ORX_ HPExeO$?bR!VbPOqsS]arg ] wF6 OBH!˾Ѿ$%%G_mwHp pbufw ~x HP " qOVn Ox`>L" Oq sV"!" B Hy V :@_cw x .GY x mYa$]  % %G p_m ;y!R x q sQ :yj R<jQ`P (y RQxPM HxV ]U  \q OR_ HP_ HPQP jRQ0PH hbuf ~ HWq!"% Oq% sV"!"8#wOpadOW4!P0#nO Q!P!PHOqsS`#rppsQendsw(swParg ] joqsQ qsQ?B Hy w _cw x +; x $;C$  % %G p_m y!xUqsR o,q sR iqOV!q<sPO&NO'MO'MO'MO'MO&9O'8O'8O(sum:O+6?<6)*Y*H+x)*H+x,0 &XO'WO'WO&DO'CO'CO'COs- :H@$/PintNP7IGIM PU (,#% e. 0,PU sS wc> ps0P ( ret+%P:%%0U intMN B:UxA:[ APMC,|,&&1U intMN Ba$B%TxA%\ APMC,SyDVW )- _cwFV 2@FV CH2X7Y iZ,Q U<a%]Cb%[ _V w<|%[C}%] ,%H?&16Jint` DD`HDgU w%3SDA aH:6T xG` PQR mSw MT%P'18lintNP7IGI u[aMUP U cIK2'5 F X d t ~:X \  C`\ Kah Sb [c dd% je7 qfI {g io j L lc mj n Ko% q sq u| w x y z { 5}N w a >\%Io  ]K#aV#Q  ,#arg#Zou %%8T $vVa$oUi&,Wap'Szpp u(3intNP7IGIM U cI/2'5 F X d t ~:X@  C`@ KaW Sbl [cs dd% je7 qfI {g i^ jz L lG mN n Ko% q sU u` w xk yq zw {} 5}N  [ P f > @ l % I ^  ]/#a:#Q  ,#arg# Z ,9 d-U# n.U# c/%# v0U# 1U# 2,# 3U# 4U# 5,# =6P#$ 7,#(9 C >,#dir?# @,# A,# CR%U`QUdQ aQcpSUST,pU,lV,hW,dX,`Zj]je1`cP_,XdpWTnpUVTn,T%R%PM,Pz G/HcK%V:,P8npUVPn,h,PqP(4(4PnpUVU n6,6,Pq6Pmn,P<R/<Pn7,V7,Pq7PP%@,PqAP!RP4n ,LJqRdqP  "9,#8,#8,sum:,$:%q*5intM U 6I%5J,>MH=NdN E'low'#'#2 s0 ll1 N2 V"T n!VW d!PQ $#.9DOUZepV{RQWWPQXRP@DP`ndrpnnddrrd0d1n0n1n2q0q1bbmwwmm1m0+6intM U 6I%5J,>MH=NdN E'low'#'#2 s0 ll1 N2 uT u8 vPQ w k!+p6ALWVbWmUxRPP PRP`ndrpnnddrrd0d1n0n1n2q0q1bbmwwmm1m0K  /usr/include/sys../lib/usr/include/usr/include/isochgrp.csystem.htypes.hchown-core.hdev-ino.hstat.hstdio.hstdio_iso.htime_impl.hgrp.hstdio_tag.hstdio_impl.hgetopt.herrno.hversion.hexitfail.hprogname.h`8GHH|9K :)fi|)p+:u VrcUW9UJ66Q/ɝ -I 8d+,T q`$\0h[ws=qHz9~7W(+ =_/eR~Ḁ 93UUqT:dU7<qp)~8*e,4; ../lib/usr/include/sys/usr/include/usr/include/isochown-core.copenat.hchown-core.hdev-ino.htypes.hgrp.hpwd.hfts_.hstdio_iso.hstddef_iso.hstat.hstdio.htime_impl.hi-ring.hstdio_tag.hstdio_impl.herrno.hexitfail.hprogname.h>:HdrHHHr Gq;dR cq;dRcC:.;=Td~qxcdjG~9@9~cfssrT. 'g G06~izG:fXRcqw qr=}9>lfj+q+-3x+-0bdd c +x3~qTde +:8:Uv >~ G,N.4'~BH*,h8d~Ur}~0q~\G%r~HT(c$t~ GB;Gȟ:*%xe[rx4~r~v~8*~e;~:cI# version.cE progname.cHK" w+ 9: c /usr/include/iso/usr/include/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeversion-etc.cstdio_iso.hstdio_tag.hstdio_impl.hstdarg.hversion-etc.hK* G-<x# czqvUxyyzzzlU<6=hhd+% version-etc-fsf.c? /usr/include/isobasename.cstddef_iso.hM L(.I,y+sSX( U;GK t+WGU:h40:ŀmdqƚp9 /usr/include/usr/include/isocloseout.cerrno.hstdio_iso.hstdio_tag.hstdio_impl.hexitfail.h`N*%d# &;yG) /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/includeerror.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.h Oc+U+Xdvsr* +#c9#  c +8:48:G R.(+f0d cɸ+Z*:%N$ exitfail.cc /usr/include/sys/usr/include/iso./usr/includefts-cycle.cfts.ctypes.hfts_.hstddef_iso.hcycle-check.hdev-ino.hstdint.hi-ring.hstat.htime_impl.hdirent.hdirent.hhash.herrno.h,Q G'}g;);V+oV: +:*:=rdd8:8:s |%r $dT,#UH:);- GeHuxq 8:\Ukdw +*K6:a&MeJdr||ӐUTN+HXTI,+,3EW+KQ:<p++:,dZ?'J dT.SIMcf*o;!+yU\_99G;HrYxc8:v;8Vz+T U 9h9 + 9.:T:ye*:8I:8H8Isrrr 9t 9zcrvg*d.r: 9<t qH)t;ht8r>C*d :d+'9:|+q|c c**:-qU~8V1:~+J$y9@*rfdZ|*);rԎ9x ;)yjy9j+yy9j:*d c*S0. U,qq 9tU +wUsq&  sU s- 8d;)MTr*z%c+o99x۟9kUGxY*I*,iqrG,d7HpqIs)q q>l,v:7;tH:X0qHd Uw9 9x+Afnz9:v8d) ~Ӝ:~+|G='=*wG1g * Uz#d;7F:e ;dN29k3+ZWrz+$8dTt}ӓKyG/f c<,8Vjӝ :F:F,cGLG4+G,Cx*'=.:?y9,>)--*L UeVU~,|d+caVV)Yq,2.T:~c: 9*xGA/:8:gGH.~+~9q3c;8Ve Ŭͮ#;*He~9)cq#fq&:}.d8:;dr:*Vyq,(~V+|{dW8dd:vz&T*(f **,k6HWM~UA /usr/include/iso/usr/includegetopt.cgetopt_int.hgetopt.hstdio_iso.hstdio_tag.hstdio_impl.hdpqdb9+:`\HF,(:6.:53GqIH8,*:`!5kŎVTf;Esc@s99Gcʅ~99q[dW;e7eM T-Uz@s,0z  2z9rrrtI UZiq!r9z+zUUzUG+hV dW2U-y8:8:<*+<({H8H*;qU}x G9~UU0x2:8rU~U y9rrru<.+&$I]mq'c#9rV|qǎ~U}8::'FU:/79I+~'U~8:~d8:8::c*G:T}(+~e}x58::~2&q$|3&}0q,+yV**i`X6VX: Gd_9 getopt1.cgetopt.hgetopt_int.h})d?d Gd?dM! hard-locale.ct~$);eRX +T,0N.F,:p /usr/include/iso/usr/includehash.cstdio_iso.hhash.hstdio_tag.hstdio_impl.hr$r$r#+KS-sfXHuGq\9LR,-Ih!tqX,C:T.L8,d8,d8,W;V. ōe,*JVu,.vUc<:*JIe( UW7;7;dpwdt,vrBUGLQ/&;e-I'=QCq q{/We-=q++gt,q+H @ev9 + *su9G)ō<(<:*: e:W;YiU[y+x:dwqGq:T,~9qc9.TH-d^rs=u0&>g:K@w+,A),Mq*M(9U+-Ur3/./D4'=C=:*KT:,e>(r,"z9?ze( i-ring.ci-ring.h4Hrr,8ewK+HF:;T:-I|IYGI::7::.mKxq{ /usr/include/sys/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeopen-safer.ctypes.hstdarg.hc:- U>5 quote.c,d1d; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.h\rdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnG /usr/include/isostrndup.cstring_iso.h̠Vb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHFqCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h8$GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.hy9:trsdrT:grq|qX, >4>: .%.48?: .%.$t?   ...S. .2...  . .  .Y. .4. .. .x.2.  . ...  .q. .". .B.  ..  .q...  . | 0HKj .| `K^ C. . ...7. ..$M  . H4MZ  ......| MFM'DN` ....|  l`N llN 4lxN .V. .| 0 O  .4Pk ...<lP $...| h,QL .0. $xQ  .8Q .?.,lRI .,R1 4RY  ./.,HS& .0pS| .LS# !.[. .;.. U  U 4U',\U@ 70UO &.,Vx .0dW ).`$X 4..d.G.F... &. .0[  ].h^n #.... .. ..4.Lf ...&.Q.g ]..]..!.}.i....U.$. ".:. .| 8 dp 4 Tq  . ..". .t. . .U. .. . d. .". .#. .@. .$. .M. .W. . . .$ T}b 1. $ }! . | $8 }# . $8 ~& . $8 (~# . $8 L~& . | 0 t~ .|  4 4  4( 40@ (4pL L4 .2. ... .84\d  .L.40 44`  .I.04PD 04Q . 4.  4  40<4m .!..04, H.84 ;..$4ȅ/ . 484 ..L4Ć@ . f.1.).>.D4M .\..$.<4T .[.[.|  h4) h` ,hlL F4hD .6.| ,. . .| $H,  .$HD .| ,\E .  ,ԋ\ X 0$0T2 @,, .<" .. H.,ؓG &. <  9. .. $Ȕ ., .LpQ V.w.  ... #.$Ė .$ .$ .$  .,4- .,d. .$  .$ .8ȗD . .$   .$( .$@  .| ,XJ .|  T| 0xR .| 0  !.| 4% ..4) ..4 = '. .,L$ .,p  ..,% .,' .| -+(. D@5 R..N.>.| D,x .M.  ..|   | ,+ ..| ,4  ..| ,4Tm .|  xĞ0x .| $  .| 0 J .| 0T  .| ,̠E  .| $1 .H1  .V .../.. ..0A......6.o.;..2......| ,Pe .| $,]  .| 8h  | ,^ A| L8 l | 0`   *.| L   | L ! 8t !'usagemain\'vechopt_initchopt_freegid_to_name uid_to_nameZ chown_filesJ%Version4,set_program_name|program_namePv|version_etc_va version_etcfemit_bug_reporting_address(*version_etc_copyright<4Elast_componentbase_lenbase_name`1Jclose_stdout_set_file_namezclose_stdout_set_ignore_EPIPEclose_stdoutr5y(errorverror_at_lineerror_print_progname)error_message_count;error_one_per_line exit_failureSF! fts_close fts_set fts_openfts_children`fts_read^7 _getopt_internal_r&_getopt_internalrpl_getopt,rpl_optarg>rpl_optindPrpl_opterrbrpl_optoptf=Drpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_r(Ahard_localeB Mhash_get_n_bucketshash_get_n_buckets_usedhash_get_n_entrieshash_get_max_bucket_length:hash_table_okhash_print_statistics hash_lookupZhash_get_firsthash_get_nexthash_get_entries_hash_do_for_eachhash_string2hash_reset_tuninghash_initializehash_clear4 hash_free hash_rehashu hash_insert hash_deleteNNi_ring_init7i_ring_emptyji_ring_pushi_ring_popPopen_safer$Q:quote_nquotePR1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals#^get_root_dev_inota,stpcpybumaxtostrbErpl_vfprintfeegxmallocxreallocx2reallocxzallocxcallocxmemdup2xstrdupgNxstrtoul jJxfts_openUpyNfseterrqxalloc_dietrExstrndupsNclose_stream3tcycle_check_init"cycle_checkxdup_safer0yfd_saferzrpl_mbrtowc{rpl_strndupt|vasnprintffDrpl_wcrtombVprintf_frexp Ihprintf_frexplrpl_isnanl# printf_fetchargs2printf_parse__udivdi3__umoddi3`8l'>z HKjvKM`N5 O F!,Q6^7dpu =}(At~B N4P.Q,-PR\ ^XJtabRbe'g jxUp q+tr4sTmtĞx0yJz {̠Et|91fPe]I^82 /2<>a;U_;;\z xm z E x*$_ 1 P D oUPt| 1 P D oGX8 E  D PUx8 E  D PU#*8 E  D PU0Al`t?S|iu|lu|P    % * 5 J~U"22u*~zH[Obr$#6#6/Sbq<O:u; k  4 q  l k {+uk ; 4   q l k 8{+0Huk ; Z   q ^ l . R #k qv+027LLN|!ci  2 9   64 o ~Y ~`c@ ` e T [ _|`,v;BD^|*^8U~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O(xT #0~T #0< m0#< mX#1u 5< AuFy0/"04D=?:<7979*.w GNU C 3.4.3 (csl-sol210-3_4-20050802)chgrp.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntt_ptrstrtol_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned int__longlong_tlong long intoff_tshort intshort unsigned intu_longlong_tulong_tino_tblkcnt_tblksize_tlong doublemode_tuid_tgid_tdev_tnlink_ttime_ttimespectv_sectv_nsectimestruc_tparse_groupgr_namegr_passwdgr_gidgr_memChown_optioncommand_namehas_argnostatst_devst_pad1st_inost_modest_nlinkst_uidst_gidst_rdevst_pad2st_sizest_atimst_mtimst_ctimst_blksizest_blocksst_fstypest_pad4get_root_dev_inoVerbosityV_highV_changes_onlyV_offverbosityrecurseaffect_symlink_referentforce_silentuser_namegroup_name_Boolusagech_statusemit_bug_reporting_addressmainargcargvpreserve_rootbit_flagsdereferencechoptoptcref_statsdev_ino_buf__iobrpl_optargrpl_optindoerrnoVersionexit_failureset_program_namereference_filelong_optionschown-core.cptrdiff_tpw_namepw_passwdpw_uidpw_gidpw_agepw_commentpw_gecospw_dirpw_shellChange_statusCH_NOT_APPLIEDCH_SUCCEEDEDCH_FAILEDCH_NO_CHANGE_REQUESTEDI_ringir_datair_default_valir_frontir_backir_emptymbstatehash_tablecycle_check_statefts_curfts_childfts_arrayfts_devfts_pathfts_rfdfts_cwd_fdfts_pathlenfts_nitemsfts_comparfts_optionsfts_leaf_optimization_works_htfts_cyclefts_fd_ring_ftsentfts_parentfts_linkfts_numberfts_pointerfts_accpathfts_errnofts_symfdfts_ftsfts_levelfts_namelenfts_n_dirs_remainingfts_infofts_flagsfts_instrfts_statpfts_nameFTSENTRCH_statusRC_okRC_excludedRC_inode_changedRC_do_ordinary_chownRC_errorchopt_initchopt_freegid_to_nameuid_to_namechown_filesrequired_uidrequired_gidstat_flagschange_file_ownerfile_full_namefile_statsstat_bufdo_chownsymlink_changedrestricted_chownorig_stopen_flagssaved_errnodescribe_changeuserspec_allocatedlchownatversion.cprogname.c/opt/pkgs/coreutils-7.4/libargv0saw_slashversion-etc.c__gnuc_va_listversion_etc_vaclose_streampackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cbasename.clast_componentbase_lenprefix_lenbase_nametmp_lengthcloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineexitfail.cxfts.cchdir_countergl_uintmax_tdirentd_inod_offd_reclendd_fddd_locdd_sizedd_bufa_floatHash_tableActive_dirfts_entLCO_entopt_okAD_compareAD_hashtable_sizeleave_dirpfoundfd_ring_clearfts_set_stat_requiredcwd_advance_fdchdir_down_oneprev_fd_in_slotfts_lfreebucket_headfts_allocfts_closefreepfree_dirLCO_hashLCO_comparefts_setfts_compare_inofts_statfollowfts_pallocmorenew_lenfts_sortdummyxfts_opendefer_statmem1mem2mem3fts_maxarglensetup_dirdiropenfts_safe_changediris_dotdotnewfdbailparent_fdfts_builddtypedirpoldaddrdescenddoadjustnlinksmaxlendir_fdis_dirskip_statopendiratnew_fdset_stat_typefts_padjustfts_childrenfts_readcheck_for_dirhash_get_nextenter_dirad_from_tablelink_count_optimize_okfts_loadgetopt.cREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optopt__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptexchangebottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlyprint_errorsnameendexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalresultrpl_getoptgetopt1.crpl_getopt_longopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardhash.cHash_hasherHash_comparatorHash_data_freerHash_processorhash_entryhash_tuningshrink_thresholdshrink_factorgrowth_thresholdgrowth_factoris_n_bucketsHash_tuningnew_bucketbucket_limithash_get_n_buckets_usedhash_get_n_entriesfree_entry_listhash_get_n_bucketsnew_tablehash_get_max_bucket_lengthcursorhash_table_okhash_print_statisticshash_lookupnew_entryhash_get_firsthash_get_entriesquotearg_bufferbuffer_sizehash_do_for_eachprocessor_datahash_stringa_string_valuehash_reset_tuningcheck_tuningepsilonhash_initializenew_candidateprev_failnext_primeis_primedivisorsquarehash_clearhash_freeallocate_entryfree_entryhash_find_entryhash_deletehash_rehashhash_insertdefault_tuningi-ring.ci_ring_initi_ring_emptyi_ring_pushdest_idxold_vali_ring_poptop_valopen-safer.copen_saferquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftset_quoting_flagsquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimbytesleftquotearg_alloc_membufsizexcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_vals__ctypedefault_quoting_optionsslot0nslotsslotvec0root-dev-ino.croot_d_istatbufstpcpy.cstpcpydestumaxtostr.cumaxtostrvfprintf.crpl_vfprintfformatoutputlenbufxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupxstrtoul.cstrtol_errorLONGINT_OKLONGINT_OVERFLOWLONGINT_INVALID_SUFFIX_CHARLONGINT_INVALID_SUFFIX_CHAR_WITH_OVERFLOWLONGINT_INVALIDbkm_scalescale_factorbkm_scale_by_powerxstrtoulvalid_suffixes__func__overflowinvalid_argfseterr.cfseterrxalloc-die.cxalloc_diexstrndup.cxstrndupclose-stream.csome_pendingfclose_failcycle-check.ccycle_check_initcycle_checkis_zero_or_power_of_twodup-safer.cdup_saferfd-safer.cfd_safermbrtowc.crpl_mbrtowcinternal_stateretcountrpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerargumentargumentsdir_startdir_endwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memorybuf_neededlengthbuf_malloceda_allocatedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharacterstmpbufpad_ptr__x_ntmp_memsizesign_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3/gcc/libgcc2.c/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3-i386-build/gccUSItypeUDItypeDWstructDWunion__udivdi3__udivmoddi4__cbtmp__umoddi3.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.1.rodata.str1.4.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo@T' H H /"7o**Eo\+\+Ro--c //@o B//( s$2$2`x66d~@@ 288 2DD ,  ,LLX|$$$$$$,,44       !' 08/h)822-F@_RBy7^Ep!k,g {r x0 10707011d719c19000081ed0000000000000000000000014a5bb2cb0002df840000012e00000002ffffffffffffffff0000001900000000root/opt/aosug/bin/chmodELF 844 (,+44o((((t PPX/usr/lib/ld.so.1  !"#'(+-./01345689=>?@ABCDEFGHIKMNQSTVWY\]^adefijkmnprstvxyz{ $%&)*,27:;<JLOPRUXZ[_`bcghloquw|}~  +<9 A9 MU_jxxK M QL hQ  Q \RI R1 'RY 68S& @`S| JU SU _LU@ oUO xVx TW [ ^n Tp   /   '5 ;HV^it2 , ԑ" Q &3x_ BQ_kv1    Đ 2 ?M Hd3 ]J f6nxt 07P   !p6;  $  6XLk () $) `7L p ؁. %L 7-BE ND ZlI  fXJ` p6w7P6 ء S# . % 7566|E m }# 4%}! 077 5B05L!T$U' ]5c7j {6 6@6g T 7X @e J p5}&  Q .Gj ?3F b0 qT- 82  ^  75P$  `L 48"m P7%L" 0 ;$ DP4M54T5ZD e4kd~ w   65 8 3 ` `     J  / ' C \L O @5`4V 06` (g 0 P5o $? | 89  tO @/ 5\p7 81 ,+  d x= ;`5 D Ў.  9    ؐ " 4( f 5 Ld B 6I , W @ $' r z & ( xJ # 4 <   @ D}b  Р  \  P7% X .  =  L `6p4V 4` G L$% p   | @D  7 @7 7  3 4 @$ Dq   8~  ܠ'   % IF 4 ĝD = P ] <~& q 5| 4 5 ( K  0J'  L) X 6 J   H^  Ԅ  Q { 6 5 54% IZ @ L N ~# c M o ̜   ]  H 7A ܟ @  I chmodfsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummychmod.cversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cerror.cerror_tailexitfail.cfchmodat.clchmod_rplfilemode.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt1.chard-locale.chash.ccheck_tuningallocate_entryfree_entryhash_find_entryi-ring.cmodechange.cmake_node_op_equalsopen-safer.copenat-proc.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.csave-cwd.cvfprintf.cxgetcwd.cxmalloc.cfseterr.copenat-die.cxalloc-die.cxstrndup.cchdir-long.ccdb_advance_fdclose-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.cmemrchr.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.sget_quoting_styleexit_failurefchmodatmode_create_from_reffd_safermbsiniterrnorpl_optindfchdiri_ring_empty__ctypegetenvbindtextdomainxzalloc__umoddi3_finirpl_optargiswprinterrorfree_cwdi_ring_init__fpendingxfts_openrpl_mbrtowchash_stringquote_nerror_print_prognamerpl_strnduphash_deleteversion_etcbase_namestrchrstrnlenclosedirchdir_longfts_closequotearg_n_style_memxmemdupwctombmemmovexstrdup__environ_lockopenat64clone_quoting_optionshash_initializerpl_getopt_longumaskrpl_getoptfwritestrerror_r__flsbuf_environfts_setfclosewcslencycle_check_initsprintf__deregister_frame_info_bases_endopen64error_message_countdirfdfts_readrpl_vfprintfmemcpyrpl_wcrtombclose_stdout_getopt_long_r__fsr_init_valuehash_do_for_eachset_program_nameatexit__register_frame_info_baseshash_get_firstquotearg_n_styleldexpquotearg_freerpl_isnanl__assert_c99lstat64set_quoting_flagshash_get_n_bucketshash_table_okabort_get_exit_frame_monitorclose_stream_DYNAMICseekdirrpl_getcwdquotearg_nquotearggettextxmallocqsorti_ring_popfputshard_localequoting_style_valsVersionstrncmpfflush_start_PROCEDURE_LINKAGE_TABLE_hash_get_nextquotearg_colon_mem_lib_versionprintf_frexplhash_print_statisticsclose_stdout_set_file_nameopenat_restore_faili_ring_pushstrcmpfdopendir_etextmemrchrmode_compile_mcountstrmodeversion_etc_copyrightmemsetvasnprintfxalloc_diedup_saferx2reallocquotearg_char_memopen_saferquotearg_n_memusagerpl_opterrset_quoting_style_exitfts_childrenhash_lookupxcallocquotearg_charhash_get_max_bucket_length___Argvxgetcwd_GLOBAL_OFFSET_TABLE_get_root_dev_inoquotearg_memprintf_parsequotearg_alloc_mem_getopt_internal__1cG__CrunMdo_exit_code6F_v_fseterrset_char_quotingmemchrxstrndupquotearg_stylequotearg_allocreaddir64setlocalequotearg_bufferrestore_cwdhash_get_entrieshash_get_n_buckets_usedstrspnprintf_frexp__longdouble_used__fpstartstrcpyquoting_style_args_getopt_internal_r__fsropenat_save_failcycle_checklast_componentsave_cwderror_one_per_line__dso_handle_getopt_long_only_rfstatat64fstat64mode_adjust_Jv_RegisterClassesprintf_fetchargs__iobbase_lenhash_clearxreallocclose_stdout_set_ignore_EPIPEversion_etc_vahash_freefilemodestringstrrchremit_bug_reporting_addresserror_at_linerpl_getopt_long_onlyhash_insertquotearg_style_memhash_get_n_entrieshash_reset_tuning_edataquotearg_colonfcntlhash_rehashrpl_optoptopenat_proc_namelibc.so.1SUNW_1.23SUNW_1.22SUNW_1.21SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/lib y y y y'= (= &qN /7 ?                                  g%y,z#m-]' !"#$%'.1s2+ &,-.8/xod1^:t[678905n!h7qE_rwO3ij \9baekvID<LMT x$4L8<@H<PMX\a`wdhflptcx|Y1k45v{G8b*Ud-x@# j!+>;3 CT  $(,]04"8<9@)DHPLZ5,%0%4h%8h%<h%@h%Hh %Ph(%Xh0%\h8p%`h@`%dhHP%hhP@%lhX0%ph` %thh%xhp%|hx%h%h%h%h%h%h%h%hp%h`%hP%h@%h0%h %h%h%h%h%h%h%h%h %h(%h0%h8p%h@`%hHP%hP@%hX0%h` %hh%hp%hx%h%h%h% h%h%h%h%hp% h`%$hP%(h@%,h0%0h %4h%8h%<h%@h%Dh%Hh%LhjjPt Rhtt P}Eu TRU RP_"E PPV^URQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[Rt :ҋu鋃t Pƃ]ÐUS[ÇP$tSjPPg|t,t |PQ]USP]t,P5 Ph6ZYPh 9 S5 5 5 h$YXh h@$XZh h$YXh h<$XZh h@$YXh hp$XZh hj$ hQ5 YZPhA$Y hhh"$:XZh h $1$ C 5 tZYPh\$UWVSE 0Dž0Dž,Dž4ƅDž ^_hjY[hh$$J    jh@hu uA (f=t#=~C G + U D1򮋵,,э\194@0,,P, 'vv+}olg] jvXGuRu߃ jh@hu u _@ 0k  ;U~  O O  WjU  hPDb )AQ@A8ۃ ƅƅ$=@xrqac] N=to=<+ C44P0N`0 ƅƅ= t.ZJW11 uG9s= 1O3't ۃCHPKƅRWXK} hÃIP%PQO_ZPS = Tà ']5xt= 1ۃ 1$=  h %j=@5 jP5LЃ %HP Y^8PS XZ9PIP ƅBƅR[Phy Pjjt = ƅPj @ j5 1@5 PAK 9jP r Rƅ # hXP tm= t1 zMPhU P5xjL 1 @M[^Ph<$Ep LPht Pjj h Pjj j hX $vƅ= u mLPhH P5xj?붃hjLPj LPh Pjj %@ RjP %= = KPh PpJ=  KPh\ PjX,u H P=  2KPh5 Pr= r JPhJ Pq h< hM P5xj( h W  hoJPhhJ P5xjA 7JPhh P5xj y00 M P 0 0D  jD  j9=}]Rjh]hj5 hhzh wj hC Pjj>Xj0t0E 9Lt% h Pjj EU tHPhà 0HPhiUWVSj/]SL]t@EE)؃~0uu]uv e[^_UWVS EuEEEM }1ۍV Cu  WuQhu hh Ph@uXZuh$ w$ uhE EEe[^_U uhփ uhɃ uh 뼃 uhL믃 uht뢃 uh땃 uh눃 uhx uhhWuhuUEPuuu u Uhh$ hhh$XZh hw$SD$1ۀ/u @/t҉t&t1At/uAҳuv[ÉWT$1эAv|/t_HUVSuV8YuV$VVe[^ÉP</ZtPSVe[^Ív@PSD$ ÉD$ ÉUh Yta= t =x tO h/J tM P R(RPhF5xj"  P h ?YuÉPhJ5xjUWVSu uh Ru? H     h =uue[^_ÉRhSV)t h;CƒPRhHh = H yvh j w WUh tЃEPuU EQ5 hPh EPuU EÐUVSu]t95 t\ 5  h tSVSUtjPh C[^EPuU EGe[^Ð 9tSPtP5 h]h VSUuSxYUWVS}StoE 8/tgPu uP ]3P-~,ofF>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PuEM$@A}VuuU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7Whw螽ZYPh 衽U$?r뵋Et)M x-t}Pu蜿EtBU x-+ U$rPM 1Sh0ZYPh  }$E$U$@C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3聾u(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2PhP^_Ph UȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1QhpW_ZPh Z}$ }1}ыELU$JMA B?C}]ȉ}EE t0ShZYPh U$RUCVE 0Sh跸ZYPh 躸cut$E t0Sh臸ZYPh 芸M$Q׊EэLE$HU::M 41Sh:ZYPh =}$GE!VE 0Sh ZYPh  N]M$Q1ыE$LH?}71Wh请[^Ph 買E$@ESuuTE$P1ыE$LH?}7E 0Qh K_ZPh NMM$} 47ShPZYPh !Uh u uuuuu  u  $   , (   ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuVtw PtehVtSP苶t(hVƵtSPeu1SV蠵$he[^_ËD$@ËD$@ ËD$@VSD$ X19v*vtAB@u9v։9w[^WVS|$_119vtFABvA@u9w9w t1[^_9Ot1UWVS u[[u@Yu=ZuBWhu Eq Vhu `1҉$S,$1҃RV,$ $Shtu 2uhu e[^_UWVSu} vWVƒ9Fv<1҅t3WVu[u1ҍe[^_Ëe[^_0UMQ1tIv9vtUVS]su VS‹K9v7Ѕt90t"@vu 9r1e[^É@tڋ蠳UWVSD$p19ދl$|$v"t9sRDAu9w[^_]UWVS E0@19v0t"u3U t[GuUB9wэe[^_ÍvVSL$ t$1)1Au[^ÉWV|$ p^_ÉPBEuEt1ApÉB Euu+BEuuEuÍvUWVS,}] M j(踲ƃ1*^'{u?1ҋERP,$sكtn}fE fEm}mEE}wKM vY 9Es1҉uԅtEԋEԍ@9ˉEr1҉uԅu.؃ V轱e[^1_ù 렻p.Nw΃jQٲ‰tF‰FEFEF F F~F$e[^_ÍvUWVS }7G9vzvtj^O SG$҉C_$t,t 3ыSG$҉C_$O u׍vu-FG9wG Ge[^_à 6уNjO 뾉UWVS EP ҉Ex8@9vh7t#t 3MQ [uUB9wЋM9v-v_t sS uUB9w֋MY$ sSu E0ʯUUe[^_鵯E@낍vU@$t ‹@A$ɉÐ j貯ƒÐH$JP$UWVSƊE EvRVƒ9^E1t&RWVt4};t KuIe[^_É0WVu[Cue[^1_ËS}:tŋBC QSʉ>-UWVSEp pppu ǃ 1UB$G$EB;EvUtqv;]FC^]tKwPEW4ƒ9wSɉUuUG ;]tډ}]uUBE;Ey E0̭UGBGBG B G$B$<$襭e[^_ÉtEFBV71UVS] ۋu%jEPډt e[^ÉEu;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]suUSPMɋU t1 APq1uxuEx ]Ív` ȐUWVS}MxWɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU xtUEe[^_ÐU덿` nUuju uBÐUVS; 5$ s t8C; rF= t P    t V$   e[^ÍvUWVSƅxUE$ #95 wyV EUE}PPX}ã$ t  S= M)1<E E UP|PRE؋E 0uUuUi 9EwI@ Et Wՙ u_Duu܋U 2uuU Exe[^_É1KvUh` EU jÍvUh` uEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<}`  EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUShPh]:1҅ux|hSCډЋ]US ]Cjhb1҅xЋ]ÐC҉Ћ]ËT$x D$UBD$USP]x PACE]UWVSuu PP}DžƋtRWSjPa9rۉx1e[^_Í9t xV蓖xxO WUjjAtÃ=x u US]S\t]ÅtvUS ] Su聖t]ÐtvUSR]M ۋtsB‰U ]X[u@wvUS]S\ SjPܕ]Uu uÖt1US] S SuP]ÍvUW U1QR}UVS]PuE PS请t e[^Ð1҅tK8uut7 hPhm螓 Pjj虫e[^\D$H Uhd Pu PZݓUh< Pu P2赓UhPhJj P艓Uu uS tUVSPhR3胔ƃxx P֓u 31e[^hj/97)=~YRhj/V )=uE/u2ChSq4)=9saEtSExx Pxaxhhhhj u uEx Pu1hjƅPjhaT蝎TXƅSRPeLt L蒎rlX$D9h ( T&L  PTƅS xL.atW11 t thXQWTup%=@rD9X`lh11 F0+41эq9w~E 2,9>r,9,P4膌,+ ;WPQ)R脍04)0PV0\00/(H9ʉD $m$ 3<38 MLt L,4,B;0+0WS04;u MeE8U҉4) ,441Ge<. xLgSxu9t0ƅjL_XL#xu xLt L؊StH T5<811 {xe[^_ËxEtxe[^1_Ë4EE̓ 4aσS4͉EUz0B/x%x> x "x"UWVS u ]}tmtb W]u0KI;w0CJu+;<+889؍49Ήs;<<  9Љ ـE@tt Ju0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 <cMBDž$4$w $ DB9s$9uʁ,w , DB9s9Ӊ,u8fQ8@WcK}09 d I]PS 6xW #8;8s;<< t&<;8-3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @~]Lt Lc] uU]|1xXDE |nKI;w0CJu + $_ 1ۃ؃w ICNCFC? <{\2 X{iCnCf+ <Xe tsti;vLIJ8JP8@VLY/ PWyG0AO󋕸IJ;w AOu8P8@SXv0C:1twC!0CN@m E 21 EEEsEEc E %E EF9sE_;UlURU> P}J P?J u,JEEG E.EE E PIEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt PHx AURU PHUWV(D$@T$DL$ ƅҋD$. write errorUnknown system error%s: %s:%d: %s:..--POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous state->magic == CC_MAGICPOSIX# entries: %lu # buckets: %lu max bucket length: %lu /proc/self/fd/%d/%s/proc/self/fd/proc/self"*dir != '/'`invalid argument: %smemory exhaustedchdir-long.c! close_failPATH_MAX <= lenslash - dir < PATH_MAX0 < lendir <= dir_endcycle-check.c%#.0f%+d(NULL)changesrecursiveno-preserve-rootquietreferencesilentverbosehelpversionliteralshellshell-alwaysc-maybeescapeclocale7.4Try `%s --help' for more information. Usage: %s [OPTION]... MODE[,MODE]... FILE... or: %s [OPTION]... OCTAL-MODE FILE... or: %s [OPTION]... --reference=RFILE FILE... Change the mode of each FILE to MODE. -c, --changes like verbose but report only when a change is made --no-preserve-root do not treat `/' specially (the default) --preserve-root fail to operate recursively on `/' -f, --silent, --quiet suppress most error messages -v, --verbose output a diagnostic for every file processed --reference=RFILE use RFILE's mode instead of MODE values -R, --recursive change files and directories recursively --help display this help and exit --version output version information and exit Each MODE is of the form `[ugoa]*([-+=]([rwxXst]*|[ugo]))+'. %s home page: General help using GNU software: Report %s translation bugs to Rcfvr::w::x::X::s::t::u::g::o::a::,::+::=::mode of %s changed to %04lo (%s) %s: new permissions are %s, not %smode of %s retained as %04lo (%s) neither symbolic link %s nor referent has been changed it is dangerous to operate recursively on %suse --no-preserve-root to override this failsafeit is dangerous to operate recursively on %s (same as %s)cannot operate on dangling symlink %sfailed to change mode of %s to %04lo (%s) failed to get attributes of %scannot combine mode and --reference options License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous # buckets used: %lu (%.2f%%) unable to record current working directoryfailed to return to initial working directoryB=fff?̌?OO?A=@??P3344&464F4V4f4v44444444455&565F5V5f5v55555555566&666F6V6f6v66666666677&767F7V7f7v77777777788  KK s  `0```.`oooT,o 1p1`o`o``(8?  zR|0 L 8t 4 0 T,,. p1 1 3 8   (P( ( ( 0 8     !"#$%&'()*+ *=R ]dp{  ( ( 0 8    <9  9 &. 8@E  S f s }     %-xK 8 H ZepM {QL hQ  Q \RI R1 RY 8S& `S| U U LU@ UO Vx *TW 3[ F^n P{Tp Y (eo}p  /   5 H %0 9 ? F$ N` (ft2 , ԑ" Q  #0 ;x_ J UdJ r~ 1 !0: @, M4 Z h t Đ  M d3 J 6x 07P   !p6+;  0$ 8 BHS6\XLk b() k$) w`7L p ؁. L 7E D lI  XJ` 67P6 ء S# . 1% 97@5I6P_6h|E ~m }# 4}! 7 505!$U' 57 6 % 6, @ @6F g O T \ 7X c @e o J p5| }& Q Gj 3 0 T-  8    ^ 7- 55 P$ G  Z `L h 4n 8" m P 7 L"  $ P4 5%4 5 D 4 d~     6 5 8 ' 3 A ` O ` b o  }  J  ' \L @5T `4 06 ( 0 P5 $? 89 q tO @/ 5p7 81  ,+ #  d - x= `57 D I Ў. T  c 9 i  t ؐ 4 f Ld 6 , @ H$'  & (xJ 4 <    @ ) D}b : X Р  ` \ q P7x X   `6U p4 4 G $%   @D   7 @77 3(4/@$BDq  U8~ [ܠ' l  xIF ĝD <~& 545  (   0J'  !L) 6J   * H^ 9Ԅ C Q 6R5"5!4ZIZ uL ~# M ̜   ]  H 7 ܟ @  I chmodfsr.s__get_exit_frame_monitor_ptr__do_exit_code_ptr__fsr_init_value_ptrtrap_tablecrti.svalues-Xa.cDdata.dataBbss.bssDrodata.rodataDpicdata.picdatacrtstuff.c__CTOR_LIST____DTOR_LIST____EH_FRAME_BEGIN____JCR_LIST__p.0completed.1__do_global_dtors_auxobject.2frame_dummychmod.cverbositylong_optionsdev_ino_buf.0diagnose_surprisesforce_silentrecurseexchangeget_root_dev_inoumask_valueversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEerror.cerror_tailold_file_name.0old_line_number.1exitfail.cfchmodat.clchmod_rplfilemode.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cgetopt_datagetopt1.chard-locale.chash.cdefault_tuningcheck_tuningallocate_entryfree_entryhash_find_entryi-ring.cmodechange.cmake_node_op_equalsopen-safer.copenat-proc.cproc_status.0quote.cquotearg.cslotvec0slot0nslotsslotvecdefault_quoting_optionsquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.csave-cwd.cvfprintf.cxgetcwd.cxmalloc.cfseterr.copenat-die.cxalloc-die.cxstrndup.cchdir-long.c__func__.1cdb_advance_fd__func__.0close-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.cinternal_state.0memrchr.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cwide_null_string.0printf-parse.clibgcc2.c.LFB3__CTOR_END____DTOR_END____FRAME_END____JCR_END____do_global_ctors_auxcrtn.s_END__START_get_quoting_styleexit_failurefchmodatmode_create_from_reffd_safermbsiniterrnorpl_optindfchdiri_ring_empty__ctypegetenvbindtextdomainxzalloc__umoddi3_finirpl_optargiswprinterrorfree_cwdi_ring_init__fpendingxfts_openrpl_mbrtowchash_stringquote_nerror_print_prognamerpl_strnduphash_deleteversion_etcbase_namestrchrstrnlenclosedirchdir_longfts_closequotearg_n_style_memxmemdupwctombmemmovexstrdup__environ_lockopenat64clone_quoting_optionshash_initializerpl_getopt_longumaskrpl_getoptfwritestrerror_r__flsbuf_environfts_setfclosewcslencycle_check_initsprintf__deregister_frame_info_bases_endopen64error_message_countdirfdfts_readrpl_vfprintfmemcpyrpl_wcrtombclose_stdout_getopt_long_r__fsr_init_valuehash_do_for_eachset_program_nameatexit__register_frame_info_baseshash_get_firstquotearg_n_styleldexpquotearg_freerpl_isnanl__assert_c99lstat64set_quoting_flagshash_get_n_bucketshash_table_okabort_get_exit_frame_monitorclose_stream_DYNAMICseekdirrpl_getcwdquotearg_nquotearggettextxmallocqsorti_ring_popfputshard_localequoting_style_valsVersionstrncmpfflush_start_PROCEDURE_LINKAGE_TABLE_hash_get_nextquotearg_colon_mem_lib_versionprintf_frexplhash_print_statisticsopenat_restore_faili_ring_pushstrcmpfdopendir_etextmemrchrmode_compile_mcountstrmodeversion_etc_copyrightmemsetvasnprintfxalloc_diedup_saferx2reallocquotearg_char_memopen_saferquotearg_n_memusagerpl_opterrset_quoting_style_exitfts_childrenhash_lookupxcallocquotearg_charhash_get_max_bucket_length___Argvxgetcwd_GLOBAL_OFFSET_TABLE_quotearg_memprintf_parsequotearg_alloc_mem_getopt_internal__1cG__CrunMdo_exit_code6F_v_fseterrset_char_quotingmemchrxstrndupquotearg_stylequotearg_allocreaddir64setlocalequotearg_bufferrestore_cwdhash_get_entrieshash_get_n_buckets_usedstrspnprintf_frexp__longdouble_used__fpstartstrcpyquoting_style_args_getopt_internal_r__fsropenat_save_failcycle_checklast_componentsave_cwderror_one_per_line__dso_handle_getopt_long_only_rfstatat64fstat64mode_adjust_Jv_RegisterClassesprintf_fetchargs__iobbase_lenhash_clearxreallocversion_etc_vahash_freefilemodestringstrrchremit_bug_reporting_addresserror_at_linerpl_getopt_long_onlyhash_insertquotearg_style_memhash_get_n_entrieshash_reset_tuning_edataquotearg_colonfcntlhash_rehashrpl_optoptopenat_proc_name@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008@(#)SunOS 5.11 snv_111a November 2008GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)GCC: (GNU) 3.4.3 (csl-sol210-3_4-20050802)@(#)SunOS 5.11 snv_111a November 2008ld: Software Generation Utilities - Solaris Link Editors: 5.11-1.1652% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  : ;I I !I/ : ; I8 &I : ;I8  : ;  : ; I : ; I<  : ; ' II: ; I : ; ( .? : ;' @ : ;I 1.: ;' .? : ;' I@ 4: ;I 4: ;I!4: ;I " U#4: ;I$1%1 &1'41 ( U)1* U+41, -.: ;' I .: ;I/ 0.: ; ' I 1: ; I24: ; I34: ; I4 5: ; I6.: ; ' 74: ; I? < 85I94: ; I % 4: ; I?   I&I$ > % $ > .? : ; ' @ : ; I 4: ; I4: ; I  I&I 4: ; I?  % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' @ : ; I : ; I 4: ; I &I4: ; I.? : ; ' @ I!I/ 4: ; I? < !% $ > $ > I!I/ &I4: ; I?  % $ > : ; I$ > .? : ; ' I@ : ; I 4: ; I 4: ; I  I &I 4: ; I .? : ; ' I@ % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I &I U 4: ; I 4: ; I? < I!I/ 5I% : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .: ; ' @ : ; I : ; I 1 1 U41 &I.: ; ' 4: ; I4: ; II!I/.? : ; ' @ .? : ;' @ : ;I 4: ;I4: ;I ' 4: ; I?  4: ;I?  !I/ 4: ; I? < % $ > $ > 4: ; I?  5I% $ > $ > : ; I I: ;I : ;  : ; I8 .: ; ' I@ : ; I &I .? : ; ' I@ : ; I 4: ; I 4: ; I  UI!I/4: ; I? < % $ > $ > : ; I I: ;I : ;  : ; I8 : ;I8 I !I/ .? : ; ' @ : ; I : ; I 11.: ; ' I : ; I&I% : ; I$ > $ >  I : ;I : ; : ; I8 : ;I8 I !I/  : ;  : ; I : ; I<  : ; ' II&I: ; I& : ; I8  : ;.: ; ' I@ : ; I 4: ; I: ; I .: ; ' @ 4: ; I  U 4: ; I ! ".: ;' @ #: ;I $4: ;I %: ;I &4: ;I '.: ;' I@ (.? : ;' I@ )1*1+.: ; ' ,: ; I-4: ;I. : ;/4: ;I0 U1 : ;21 341 415.: ;' I 6: ;I7.: ; ' I 8 9: ;I: ;41< =.: ;' >4: ; I?4: ; I? < % $ > $ >  I: ; I : ;  : ; I8  : ; I 8 : ; I8 &I  : ; ( .: ; ' @ : ; I : ; I 4: ; I 4: ; I4: ; I  4: ; I U.? : ;' I@ : ;I : ;I 4: ;I 111  U4: ;I 4: ;I .: ; ' I !: ; I": ; I#I$!I/ %4: ; I? < &4: ; I?  % $ > $ >  I : ;  : ; I8  : ; I8 &I  : ; ( .? : ; ' I@ : ; I : ; I .? : ; ' I@ %  I$ > $ > .? : ; ' I@ : ; I 4: ; I 4: ; I  &I% $ > : ; I : ;  : ; I8  : ; I 8 $ >  I  ' I I & ' &I.? : ; ' I@ : ; I 4: ; I  .? : ; ' @ 4: ; I.? : ;' I@ : ;I 4: ;I 4: ;I .? : ;' @ .: ;' I@  : ; 11 1 41 !.: ;' I ": ;I#4: ;I$ U%.: ;' @ & U% $ >  : ;  : ; I8 I!I/ $ > : ; I .? : ; ' @ : ; I : ; I 4: ; I  I.? : ; ' I@ &I4: ; I .? : ; ' I@ % $ > $ > : ; I : ;I : ;  : ; I8 : ;I8 I !I/ : ; I8 .: ; ' I@ : ; I 4: ; I I.? : ; ' I@ 4: ; I  : ; : ;  U4: ; I4: ; I 11 U&I.: ; ' I : ; I.? : ;' I@ : ;I 4: ;I !: ;I " % $ > $ > : ; I: ;I I.? : ; ' I@ : ; I  4: ; I  4: ; I &I% $ > $ > : ; I I: ;I : ;  : ; I8 I !I/ : ;I8 .? : ; ' I@ : ; I : ; I 4: ; I  U U&II% $ > $ > .? : ; ' I@ : ; I : ; I  I&I .? : ; ' I@ % $ > : ; I$ >  : ; (  I : ; : ; I8 I !I/  : ; : ;I8  : ;I8 .? : ; ' I@ : ; I 4: ; I 4: ; I.? : ; ' @ 4: ; I .: ; ' I@ : ; I &I : ; U4: ;I  U4: ;I   .? : ;' I@ : ;I !: ;I "4: ;I#1$1%.: ; ' I &: ; I'.? : ;' @ (.: ;' I@ )4: ; I?  *!+4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' I@ : ; I 4: ; I  I%  : ;  : ; I8 $ >  I$ > .? : ; ' I@ : ; I &I .? : ; ' @ % : ; I I$ >  : ;  : ; I8  : ; I 8 $ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  &II!I/4: ; I? < % $ > $ >  I.? : ; ' I@ 4: ; I 4: ; I? < % $ > : ; I$ >  I .? : ; ' I@ : ; I 4: ; I 1 1 U 41 .: ; ' I : ; I4: ; I &: ; I &I% $ > $ > : ; I I : ;I : ; : ; I8 I !I/ : ;I8  : ;  : ; I : ; I<  : ; ' II&I: ; I.? : ; ' I@ : ; I 4: ; I  U4: ; I % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' @ : ; I % $ > $ > .? : ; ' @ : ; I 4: ; I? < 5I% $ > $ > .? : ; ' @ 4: ; I? < 5I% $ > : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I  I &I% $ > $ > : ; I I: ;I : ;  : ; I8 .: ; ' I@ : ; I 4: ; I 1 1 U41&I.: ; ' : ; I4I4  4: ; II!I/ .? : ; ' I@ 4: ; I 4I4   : ;  1 U1 .: ; ' I !4: ; I? < % $ > : ; I : ;  : ; I8  : ; I 8 $ >  I .? : ; ' I@ : ; I 4: ; I 4: ; I 4: ; I? < % $ > $ > : ; I: ;I : ;  : ; I8  : ;I8 I !I/ .? : ; ' @ : ; I  I.? : ; ' I@ : ; I 4I4  11&I.: ; ' I : ; I% $ > $ > .? : ; ' I@ : ; I % $ > $ > .? : ; ' I@ : ; I  U4: ; I 4: ; I? < % $ > $ > : ; I I: ;I : ;  : ; I8 I !I/ : ;I8  : ; : ; I.? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U 4: ;I4: ;I  4: ;I  U4: ; I? < % $ > : ; I$ >  : ;  : ; I8 I!I/ .? : ;' I@ : ;I U 4: ;I 4: ;I  I&I% : ; I$ > .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I 4: ; I U   I &$ > &I% : ; I$ > $ >  I.? : ; ' I@ : ; I 4: ; I &I% : ; I I$ > $ >  I!I/  : ; : ; I8  : ; (  : ;  : ; I&I : ;  : ; I8 .: ;I@ 4: ;I4: ;I .? : ;' I@ : ;I 4: ;I  : ; U111 1 U41 ! "41#4: ;I$ : ;% : ;I&.: ; ' I ': ; I(4: ; I)!I/*.: ;' I +: ;I, -4: ; I? < % $ > : ; I$ >  I : ;  : ; I8 I !I/ .? : ; ' I@ : ; I U 4: ; I 4: ; I? < % $ > $ > .? : ; ' I@ : ; I : ; I 4: ; I  I% $ > $ > : ; I.? : ; ' I@ : ; I : ; I 4: ; I  4: ; I U   II!I/ % $ > $ >  : ;  : ; II!I/ : ; I .? : ; ' I@ : ; I 4: ; I 4: ; I % $ > : ; I$ >  I  : ; (  : ; : ; I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I  4: ; I I!I/ % $ > : ; I$ >   : ; (  : ; : ; I  I &I  : ; : ; I8  : ; I8 .? : ; ' I@ : ; I : ; I 4: ; I 4: ; I  : ; U U 11 141  4: ;I 4: ; I4: ;I 4: ;I!1".: ; ' I #: ; I$4: ; I? < % $ > $ > : ; I : ; : ;I8  : ;I8  : ; : ;I : ;I .? : ;' I@ : ;I 4: ;I 111  U4141  .: ;' I : ;I4: ;I 4: ;I  I&I G9'/MR *7R *Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intKc  G$D7EZDew% LlRa>[  gs~ nx t{ z~ ~ >* ; <# =># S E> E##m# val# %###### #$ #(#,(#4#*#<+*#D3*#L; #TF #XP #`Z5#p > E > E % E % E k  # #`s z !`# "# ## $# %p# p Es ' htTE#F#G#H# I#J# K#M#"N# -O#$8#(D#,c#0mw#4yEc###># ##### #$#(3#,#0#4S#8S#:S#<#@&#FTS  E/&6*DS`jE2y[9;UZSy':*:n ;GU  ~~~ okpp~~!cP"f!arg~#&VS$  =>% P&# "'/ S': ~(@'G ~)[ 4>b>&l %w ~(`' }' }' }' }' }' }' }*" + $D 2 ??&C &N %Y P(' S)r @@& & & (' ~' S" H' S(`' ~' ~$ lBB& & & " x'e ~,EF5 -U A8p.I7 .O7 ok9p fts;/ ent?U 0 Yp1fts1entU 2f2y2~ 223okp2p4 # p/#/#/#" # "   2 % E 0r rp5yq5q5q/2x6 5y552" 3fmt0 v1fdu5yu5u , E;7 7r7#7/:757=G 87N [9i>p  Y 9pA 9|Dp 9Gp 9Lp 9O& 9fS   E L9^ @ FUGG/57 =BM| HGjJ#G HU"jS)jg*jppuM Nj I H+06MU%R*S R*Y8 #a9#f;#l<# r=# y? # @  # A  # B  # C  # D  # intT[Hc $[  + HjIU 0(p )Q 7)l B*W L*= J,9S *H@H T0=R.6 f`lIIU 0  7 BL=IIUHK;ylIIMint$[ O.%l@y0JIintP7!I.JT g"Pp#Q$S M  p,0JWJToRlenq,P r, KXJJUJVgLSM,P-xKJMR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # int$[  o*JJT y)oPu % OJJT %N ,lJxKU  9poP/:,;=  I$o  . uTMxKS+06MU%R*S R*Y8 #a9#f;#l<# r=# y? # @  # A  # B  # C  # D  # int$6[  [xKXLU  W f V y = K#L R w6mj fi skn(65v?XLLU   f  y=LMU f  IS Vy=E   7#:   ^H5; N NaX,MMintM$[ = %ntOMMint$Dek:[ gsr  H#}#  HMMT fP mR :   HMtOU fdH y  mH !{# "HVerr#HSbuf){/ *}S9 -HVE .HW:%/:H'v QtOP Mint$DO7EdDe: kLvRk,[ gsnx]t{z,=;<#=,#SJ#J##### #$ #(Z#,#4 #=#< +=#D 3=#L ; #T F #X P j#` Zz#p Z, % j, % z: % , % [ atO QT `Rstr`SyOOc 7:r 6 w  QQT Pstr%Hp B RpQ G0intPBM$Dl7EzDe^ LRI[ gsnxBt{zIU ;  < #  =I# S,b  #  b#  #  #  #  #  #$  #(  r#,  #4 # U#< + U#D 3 U#L ; #T F #X P #` Z #p rI P I P ^ P I Ps z !#  "0#  #B#  $B#  %# 0 Ps ' 5ht;x5x k{# # s 0#AKT Ec# Fc# Gi# H# I# J0# K0# M7# "N7# -O#$ 80#( D;#, c#0 m #4cyE cc# c# c# I# # # # 0# 0# 7#$ Ŧ#( %#, 7#0 #4 s#8 s#: s#< #@ &#Kc0KoFTS~ ` P ^ P/K  z/  - .# /# 0s#  1#p : 60# 70# 80# 9# DIR :/k   #  #  85 dev#ino#  # &  #  #k !QhQTx Uy Wax"kay#kq$ *7hQQUx)P, )7 ax+k/7 ~Q[RUfts}Tent}Wst/V  P!Q,RobjX B P5`"wH \RRU#qwS!tRR$fd 0P "V +RRU%p*V#c *P" l OR5SU%spNS%fdN0V#{ NR$oldP0P!S(S& W0P"G 38S^SU# 2S$p4P' `SSU%spp# W#7V$pS$len7P ^(  F0STU%spEV& GR$pGS&# H0W) mT}T*$ +/ ,sp'q 7UUT%xP#, 7-axq w ' U#UT%xP%yP-axq -ayq (  ,0$UKUT%sp+%p+P#+0R'? 0LUUT%aP%bP' sUVU%spV%pS# R$sbp W&# 0V.errU`'  GVTWU%spFS# F7R$pHP& I7R' ( TWXU%spV# W#&7S$ap Q$pP/1 &  p00$a P 0 (8 yX[U#v#<w0S#1x8$spzV$p{W& {S&&|7p&}l$tmp~h$len7P/A 1L (;[1Q '-[1V %[ H/_ 7)>XX2PR0`3\P3hS4 uYY*)+ZQZ**!+ZQZ3P '0''-35u[ 76~-len7-max77i 3,fts285s l09spk9dirk /{ m0' 0[^U%sp~%p~%fd0%dir S$ret0V& ~& 0~1 \:\\$sb`~4l]]**0x3P&.0S!Q^^& 0P' ^fU%spp# 0l$dph$pV& d&&7`$cur\&aX&  T& P&# 0S& O& N&%H& D&C$len7& 7& 7R$cp1L QNd4W-_f_*$*/03;V3GWo& 0S& @P!aa/ )baa*p*{!aa;4aXb**!aXb3R3S03TSp5b 7 9fd609dir6 / 80/ 9 s P\5 9p--sp-h-tmp-ent/ -t2=  /9sp.9p.-len07-cp1?/:0 }Tp intM$O[ R*JR*Y8%#a9J#f;J#l%D}}U;%; g ;q <z < =% =% > ?%P X%}}UW%W g W  r#$A;%&Fr&#U% & Z% & `%  d @b~}intM$O[ #%#m#val%# O% U   (!#%%# &%# '%#(r#  -%# 5r# W# [%#) d%# 8 e%#$  *%}}U (% ( <( ) )r q&3%}~U 0% 0 <0 1 1 d2q  A%~;~U >% > <? @ @5J%<~b~U G% G <G H H dIqvQd~I+Mint$[ W%d~Uc$9Vl&Wp'P ~~\2%S + "qMR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,c$ [ xfl         R   R R!#}$R#d %!#z)-z#.z#/z#0z# 1# 4' 80(6%6!#,77# 8#B9# Z:#=B#}D[#E#F# dI!#$=HvtTvP|9TvPQ TvP: `TvP%7QV:T7PR`TvW%7RBVZQz7PLUv0 Z BpZRLUvVW%7P7SRUvQ%7R[ (R@U'vS'V%*7R+7PYE@TCvPCYUDW FQ%G7SH7RR)eՁUcvc :dR fW%g7Vh7S'I؁TW'Q VvSchR-%Y^TYWp TQBR}z^UBS}[WPVREF5z\OQ\\ T S!"!"##4 ]҄U\W%^!V$Xd!Sd e!R ԄUp%!W!Sd !V !UQnew!R% TP!R RUVW  Ps%!S!S&z p}RW& }RW& #d !#d !!u 3U22 4W%5!p6!Sd 7!l&` }IRh!K!V$Y!R 'RAUVS}RP%!t& !Q$#Bz\y RD"USR}RV%!t$(#BP3Hp$Bs  z!#"##%#$%#%#ints',M$[  1K$MT ir1R Q iP _W&PYT ir%_P ed,\T ir+1Q val+Pp-%Ry.V9U ir81S:Q͎Mint$DO7Edd]De kLvRk,[ gsnx]t{z,P;<#=,#S']#]##### #$ #(m#,#4 #P#< +P#D 3P#L ; #T F #X P }#` Z#p m, % }, % : % , %[ opd:#me:#f#vg#h# 4q4!UpSpVpr4O4$cUOSmc4Lp?@]QxVpOQZ׋ktWop:vVm:gi4PU:~znysy" 4dUuO 7![~A8͎TM6!dir6p6$U7Sl 7, :U m =q AW ]BV vDQ"Ys ilRЎsMint$Dek[ gsr+:U HЎUy SHR P  ap# :pq6IintQ>M$DE7EoDeZ vLRv,[ gsnx>t{z,H;<#=,#S c, Ll#l##### #$ #(|#,#4 #H#< +H#D 3H#L ; #T F #X P #` ZS#p |, L , L Z L \6IU buf5 fd5% y5\7%H Y3P> ZS C%W@Hj~Ij}Jg}bZZ LayLintppLdUn%p v{M &pdyU%p- *x|intP7#GI-!;Qe+M$[ ( ,# % .7W( 51P# S4%# 8W# g7  r s,#valt#^|Uo]e_%Sp` iPĐؐToh,qؐTopspPP%|%PTo{Rc{i{%Suc}Qp~V6%Qr%P<%PtToQi%Rr%P N tT5PRo J JԑUiJSsPVoJPPN{,ԑU@,argJ, -PS%Ni,len,SJ,YYY1erm/!<7XcescPm,DYpN,RHw>DS,W)3j,R/YJV|JWT7 F,?U C C,R!argDJ D,!oEpGQeH%SrI,P ^`@U!arg^J ^, ^!o_paWeb%pSd%le,S"bufg#$,%q&n, |SU!argQJ Q, !oR';Usv;Vi7Sg(9U!n%V!argJp , < e%l"n07sv;Sn1,hYg5ě,`valWS%\,P#$pU!n%P!argJR"U!n%P!argJR ,$9U!argJ <TU!argJ , o TU!n%!sPR!argJoH U!n%!sPR!argJ ,oH ̜U!sP!argJ Q ̜U!sP!argJ , 1,U!argJ , !chP<   C,FU!argJ!ch  QH]U!argJJ ``xU!argJ , Z Z J)s).pӞ # 8S#!676K/:Z "EMint$:[ O#r"Ucwd$rP/:Hc K$WintP7M$Z[ a,$IUn+,S p-Pi8LuUp7Pn7,STrGxUpFSpnFTQ Z k t ~  R,|pÃpnTs,n,QܟUsP,SZܟUnY,sY, p[P+l!Upk+sk,S1[t}$KUWs[RaZF^!РL intQ>M$DE7EoDeZp% vLRv,[ gsnx>t{z,U; < # =,#S, p, Ly # y# # # # # #$ #( #, #4 #U#< +U#D 3U#L ; #T F #X P #` Z`#p , L , L Z Ls  z!# "%# #># $># % # % Ls' <htBN<H!T E9# F9# G?# H# I# J%# K%# M3# "N3# -Ok#$ 8%#( DB#, c#0 m#49yE c9# 9# 9# ,# # # # %# %# 3#$ |#( ɤ#, 3#0 #4 h#8 h#: h#< #@ &#!9Z%ZZ`f!EFTSTq w L Z L/!7 '|LРU%S<%% 1&Cfts(|V82 R2%228>u>"٠РMR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,$[  rР٠T fprP"+ܠMint$[  ܠUfH-+Uf,H=H? "W,intM$[ !,WU=% 0#wXintP7XwUWn, s P M  #!#x#Mint$d]:[ r0&fd'H# 7FHxסU cdbES dirER  GHV ( 5PK#:XF8cdb7XOsY;x^s#%cdkHءU dirj}VelHPO,olenqP tr}Wcdbsp|t 1! >dherrHP }S JϢ[Sd # HS( 5KpES (Wn 5K?errHP }S J%4[Sd,#% J,cdb+ pU}sTV 2Hcdb1X!/:H"$MR*7R*Y8#a9#f;#l<# r=# y?# @ # A # B # C # D # intT[,$[  :U 09V ; <S X=P /:#U%Mint$DO7EdDe kLvRk,[ gsnx]t{z,7;<#=,#SD#D##### #$ #(T#,#4#7#<+7#D37#L; #TF #XP d#`Zt#p T, % d, % t: % , %  dk  # #k# # s H# ,T +P |;| U :sb: O B  % :&|i%$ & Mint$[ "HUfd!H$F&J"Mint$[ -'HJUfd&HW f*HVe+HS/:HQt%&nLFMint$DO7Edd]De: kLvRk,[ gsnx]t{z,T;<#=,#S+ o, %x#x##### #$ #(#,#4 #T#< +T#D 3T#L ; #T F #X P #` Z_#p , % , % : % - .# /# 0V#1# : % >: 6H# 7H# 8H# 9# DIR:46vLnUbufuu fdH~A4~-;~R~Z~b~jSTdir~ ~stv~t~LS `~F!0 dAW~̯~4~HP~V 4~l 4&HP(tmpfSgWX H>/:H&5(0pintP7#GIM$[ (,#%e. pC,p0U pwcBp sBvV nB,S psBW x O  Y,l wc\>p ret],P>|P '(0?0/0Ts.&.n.%Q+547P=8SJ9~W:~V c; b~P   int   ~\(q)?0intM$Z[ l}UsVn% len%Snew}P Z()=x+06MU%intPZ#Gl6$[ HZ  ( ,#H .cl 2              0 : I U f s    X&  `aybc dH&eZ-fl7gBiPj l_mhnKoHuqUsuwxyz{} a6aHl/ ]#a#  _ O#arg_#/:,9 -# t.# S/H# *0# 61# @2O# P3# `4# n5O# ?66#$ F7O#(9p_C >O#dir?_# @O# AO# CZ B65Uh6s8=Us 0S=deXaey]X{&ND /Obufsx@sxcpViOxdp_x> sxtOxOxQv P P!R8 n*OxM+O0K!0KP` ^-O-sS  wSHwjHwnOwtHwfbpsWZwx8 argHP:P!:P"P ^6O6sSx~p "!" MCO!P ^HOHsV  Ow SMHjNHxnOOxPHxQOx. argYHP J argyHPb R arg2 x3 x4 OSw< Ox ` C x bufJ ~K HP  OV /  " ^ O sVy "!"!ֶbuf ~ HSn5 OW '>!'>"@^6 O6 sSL flh"!"9  F wSH HwjI HwnJ OwK HL OWM ORN +ytmpO sw^P swpQ sS8OS S nsOS m ɸ۸nOS <hN] !"# p^OsS ɺϺ"!"Y Hx HQ OV8 L xSM HxjN HxnO OxP HxQ OWR ORS +ytmpT sw^U swpV sS"arg^ HP >[xarg~ HPV R!P˼!˼Parg[ \!] xpad ORend sV!q sQ OS#n Og!"^ O sW 4 O1(j H 4:$l %ul %l _ml wp Hx ] HPYYk\!"vqargY HP ~argy HP!P!Parg\! $;(padORendsVH#nOy!"p^OsW RQP ]o R NQPKhQPcargR #nOTRTg!TgPH^OsS $kargyRSparg RST7argMZRTarglRS p\xargGHR xargAZR arg;HRa \q OR HPE O$/RR!FRP@^OsS]`arg ] w6p OH!$%u%_mwp bufw ~x HP "OV@n Ox`.<p"^ O sVsy"!" H V *0_cw x .7I" x mIQ$]  %u % p_m ;y!"R x q sQ *ij R,ZQP (i RrQ P8 Hx ]`a \q ORx HP HPQP jRQP buf ~ HWq!"8^% O% sV`"!"8x#wOpadOW4!P#nOQ!P!P^OsS#rppsQendsw^swP0arg ] j_qsQ qsQ?x H w  _cw x +" x $+3$  %u % p_m y!"xUqsR oq sR YyOV!<sPO&'NO'-MO'3MO'9MO'?MO&E9O'-8O'38O(sum:O+6?<6)*YJ*H+x)*_H+x, &sXO'-WO'3WO&xDO'-CO'3CO'9COs-/ :H@+[4@~intP7#GIM$P[ (,#% e. 0,@U sS wc> ps0P  ret+%P/:%+5[ intMa B:UxA:[APC,|,@,k5[ intMa Ba$B%TxA%\APC,SDVW  _cwFV "0"FV CXY iZ,Q Ea%]b%[ _"V g|%[}%] ,%H?-5&int` DvD`Dg[ w%3DA  H:&T xG` PQR mSw T%P-R6( intP7#GIu[aMUP$[ cIK2     0 :IUfsX \  `\ ah b c d% &e7 -fI 7g Bio Pj lc _mj hn Ko% uq Usq u| w x y z { } aw a >\%Io  ]K#aV#   ,#arg#o%%(T$vVa$oUi&,Wap'S p u.v7. intP7#GIM$[ cI/2     0 :IUfsX@  `@ aW bl cs d% &e7 -fI 7g Bi^ Pjz lG _mN hn Ko% uq UsU u` w xk yq zw {} } a [ P f > @ l % I ^  ]/#a:#   ,#arg#  ,9 -U# t.U# S/%# *0U# 61U# @2,# P3U# `4U# n5,# ?6P#$ F7,#(9 C >,#dir?# @,# A,# C= R%U0QUdQ aQcpSUSJ T,pS U,lrV,hW,dX,`j?]e1cP_0F,XdpWDnpUVDn,TRPM,PzX G/HSK%Vx:,PnpUVn,^,PP$$P(npUVU@ n6,h^6,P6P]n,P,R,Pn7,V^7,P7PP%{^@,PAP!RP$n ,L:aRTaP  "E9,#-8,#38,sum:,$/:%0:_ intM$[  I% J, MH Nd a 'low'#'#2 s0 ll1 2  T u8 vPQ w W!+6ALWVbWmUxRPP PRP!ndrpnnddrrd0d1n0n1n2q0q1bbmww!m1m0Q9 ../lib/usr/include/iso/usr/include/sys/usr/includechmod.csystem.hopenat.hstdio_iso.hfts_.hstddef_iso.htypes.hstat.hstdio.htime_impl.hi-ring.hdev-ino.hstdio_tag.hstdio_impl.hgetopt.herrno.hversion.hexitfail.hprogname.h9GHH~9c$:)fi~* cwUrV/U9&7-H,eZ'99rGq 9 TVc G~6-*d~d8e:xckq~99~cgrs6>J0 f:8dn~ 8~dn&s8r.+Gq*de +} W1);db&murJ*d`f~c Wp3qn#e;ck5]Ir1e*w1J1~&UTVdm7 0dTVhSc+UU??,KclH~# version.cE progname.cG" w+ 9: c /usr/include/iso/usr/include/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeversion-etc.cstdio_iso.hstdio_tag.hstdio_impl.hstdarg.hversion-etc.h H* G-<x# czqvUxyyzzzlU<6=hhd+% version-etc-fsf.c? /usr/include/isobasename.cstddef_iso.hI L(.I,y+sSX( U;GK t+WGU:h40:ŀmdqƚp9 /usr/include/usr/include/isocloseout.cerrno.hstdio_iso.hstdio_tag.hstdio_impl.hexitfail.hJ*%d# &;yG) /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/iso/usr/includeerror.cstdarg.hstdio_iso.hstdio_tag.hstdio_impl.hxKc+U+Xdvsr* +#c9#  c +8:48:G R.(+f0d cɸ+Z*:%N$ exitfail.cm /usr/include/sys/usr/includefchmodat.cat-func.ctypes.hsave-cwd.herrno.hM,T,e~d,,* +R c9R.Y ]F,-qc /usr/include/sys/usr/include/iso./usr/includefts-cycle.cfts.ctypes.hfts_.hstddef_iso.hcycle-check.hdev-ino.hstdint.hi-ring.hstat.htime_impl.hdirent.hdirent.hhash.herrno.hQ G'}g;);V+oV: +:*:=rdd8:8:s |%r $dT,#UH:);- GeHuxq 8:\Ukdw +*K6:a&MeJdr||ӐUTN+HXTI,+,3EW+KQ:<p++:,dZ?'J dT.SIMcf*o;!+yU\_99G;HrYxc8:v;8Vz+T U 9h9 + 9.:T:ye*:8I:8H8Isrrr 9t 9zcrvg*d.r: 9<t qH)t;ht8r>C*d :d+'9:|+q|c c**:-qU~8V1:~+J$y9@*rfdZ|*);rԎ9x ;)yjy9j+yy9j:*d c*S0. U,qq 9tU +wUsq&  sU s- 8d;)MTr*z%c+o99x۟9kUGxY*I*,iqrG,d7HpqIs)q q>l,v:7;tH:X0qHd Uw9 9x+Afnz9:v8d) ~Ӝ:~+|G='=*wG1g * Uz#d;7F:e ;dN29k3+ZWrz+$8dTt}ӓKyG/f c<,8Vjӝ :F:F,cGLG4+G,Cx*'=.:?y9,>)--*L UeVU~,|d+caVV)Yq,2.T:~c: 9*xGA/:8:gGH.~+~9q3c;8Ve Ŭͮ#;*He~9)cq#fq&:}.d8:;dr:*Vyq,(~V+|{dW8dd:vz&T*(f **,k6HWM~UA /usr/include/iso/usr/includegetopt.cgetopt_int.hgetopt.hstdio_iso.hstdio_tag.hstdio_impl.hTpqdb9+:`\HF,(:6.:53GqIH8,*:`!5kŎVTf;Esc@s99Gcʅ~99q[dW;e7eM T-Uz@s,0z  2z9rrrtI UZiq!r9z+zUUzUG+hV dW2U-y8:8:<*+<({H8H*;qU}x G9~UU0x2:8rU~U y9rrru<.+&$I]mq'c#9rV|qǎ~U}8::'FU:/79I+~'U~8:~d8:8::c*G:T}(+~e}x58::~2&q$|3&}0q,+yV**i`X6VX: Gd_9 getopt1.cgetopt.hgetopt_int.h})d?d Gd?dM! hard-locale.cd~$);eRX +T,0N.F,:p /usr/include/iso/usr/includehash.cstdio_iso.hhash.hstdio_tag.hstdio_impl.hr$r$r#+KS-sfXHuGq\9LR,-Ih!tqX,C:T.L8,d8,d8,W;V. ōe,*JVu,.vUc<:*JIe( UW7;7;dpwdt,vrBUGLQ/&;e-I'=QCq q{/We-=q++gt,q+H @ev9 + *su9G)ō<(<:*: e:W;YiU[y+x:dwqGq:T,~9qc9.TH-d^rs=u0&>g:K@w+,A),Mq*M(9U+-Ur3/./D4'=C=:*KT:,e>(r,"z9?ze( i-ring.ci-ring.h$Hrr,8ewK+HF:;T:-I|IYGI::7::.mKxqq /usr/include/sysmodechange.cxalloc.hmodechange.htypes.hstat.htime_impl.hVTHV:Hr::H: P3c8:,<(:::8:U2l7qI1}:T,~+Vcv9ycckccocg_ qc<`f*IUqnL4hXp:a;Z?b-7-U:FG&U\*@K+4q:gUq.+{ /usr/include/sys/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/includeopen-safer.ctypes.hstdarg.hЎc:- U>w /usr/include/iso/usr/include/sysopenat-proc.cstdlib_iso.hstat.htypes.htime_impl.h5;7-ecT,2d4h Gk9xU3n9]5 quote.cLd1d; /usr/include/iso/usr/includequotearg.cxalloc.hquotearg.hstddef_iso.hwchar_iso.hwchar_impl.hstddef.hstdlib_iso.herrno.h|rdd:md:*r$ ,HSI}If*:rzGf*:rAII:s'V:s"c/:,VFHVtnVq)?r8H UnG8 wU +cy,IIe*d"+d,dd2#-׮~y92yce:*h8 wU +8r(.eX+~sfT,i9Uh+t-F9v /usr/include/iso/usr/includembrtowc.cstddef_iso.hstddef.hwchar_iso.hwchar_impl.hp;)e+J*ǁ:xUGU}TtqVS9`U Ue9ry> /usr/include/isomemrchr.cstring_iso.h0.+rGGK? +:qxqs# qf,jG]> /usr/include/isostrndup.cstring_iso.hVb::*JH   /usr/include/iso/usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/includevasnprintf.cxsize.hstddef_iso.hstdarg.hprintf-parse.hprintf-args.hwchar_iso.hstddef.hwchar_impl.hfpucw.herrno.h cM q_=) tl9 ӹH8:*d%cb9;t     @"c_c!c}-H3xcc5])V)cVcH)c` +cwH-as U\c-TdeGќ-H3xcc휜--JI c tc Gt+ c&c`c+`+-ci+/ r, lqlcl+lclcHc`/Q/fHdoqq%0lblclcHc` U:k+dMIHHHHHL UL UsiG GH F  GHH!G~-;-Zqp%Z%cZcH%c` y,+eU+~qnq csc8 cr9r+ c-H3xcc,)--JI + Hk+kc+,kccodcUo;iJHF9/ehH  a )Td9@_/Y$:Z"_h8:*: s ' >40xHrH*:t9XvH csc7 cq9q+ c-H3xcc,-J!+-Hg+fc+,fcclgc;/9o;fHF9/e^!H>+^GF!^+!ctq}kUFk+cqk9F&GV Ttc 9t+ +gGX+f'c~p&p.QRc.9t+ +cqUKZ&zz| G<qcu. ctG;rrej*IjqHF9q~ctKC+Xd'4~)~e+qFH= t dmec)&Td9*rmcw)@_/Y);uc|U a.* / rl+{*r~GH}+xe HǏHFkycjXllclclcHc`N_/Y)JHF= qwp{g+Fg+cqgF&. ctG;reN*I.:Z4"_h8:*: s ' >40xHH*:9i+oFo+Fo+cq|)lclc+scQ/lcblclcHc\dUFH= t dV HHF H t+~ V:#f(cd  vc e;oefHF5o&;y1Hh+ JHFt}eS*ry cr++px )HǀHFqCGt:Dq<  /usr/sfw/lib/gcc/i386-pc-solaris2.11/3.4.3/include/usr/include/sys/usr/include/iso/usr/includeprintf-args.cstdarg.hva_list.hprintf-args.hstddef_iso.hwchar_iso.hstddef.h($GKmKV8,Giz6X+quHu   /usr/include/iso/usr/includeprintf-parse.cxsize.hprintf-parse.hstddef_iso.hprintf-args.hwchar_iso.hstddef.herrno.hy9:trsdrT:grq|qX.. -.. =. . ... .'. ..  ..  ...  .| 0Gj .| ` H^ C. . ...7. ..$lI  . HIZ  ......| IF0J'DXJ` ....|  HJ HJ 4HJ .V. .| 0xK  .4XLk ...<L $...|  tMLtM  ..*...| tO} Q .| h4QL .0. $4hQ  .84Q .?.,4\RI .,4R1 44RY  ./.,48S& .04`S| .L4S# !.[. .;.. 4U 4U 4$U',4LU@ 704UO &.,4Vx .04TW ).`4X 4..d.G.F... &. .04[  ].h4^n #.... .. ..4.L4f ...&.Q.4g ]..]..!.}.i....U.$. ".:. .| 8D Tp 4D Dq  . ..". .t. . .U. .. . d. .". .#. .@. .$. .M. .W. . . .$D D}b 1. $D }! . | $ }# . $ }& . $ ~# . $ <~& . | 0 d~ .|     @ ( `L L  .2. ... .8 Ld  .L. 0 4 `  .I.0 @D 0 Q . ؁.    < m .!..0  H.8 Ԅ ;..$ / . 8  ..L @ . f.1.).>.D M .\..$.< D .[.[.|  $) P ,\L F4D .6.| ,5  .8$? ..,d3 ..85 | ,Ў. . .| 0I  =.| $L  .$d .| ,||E . |Đ |ؐ,|\ X |P$0|t2 @,|, .<|ԑ" .. H.,|G &. <|@ 9. .. $| .,| .L|Q V.w.  ... #.$| .$| .$|$ .$|<  .,|T- .,|. .$|  .$|̜ .8|D . .$|,  .$|H .$|`  .| ,xJ .| 4$ĝD ..$ .4$() ..| 0T  !.| ,& ..| 4L$% ..4LL) ..4Lx= '. .,L$ .,Lܟ  ..,L% .,L$' .| DL .M.  ..|  $Р | 4Hܠ' . ..4H' . ..| ,,+ ..| ,X  ..| ,Tx_  .hTء ......#...| ,m .|  H0H  .| $  .| 0J .| 0$L"  J.| 0lp .| 80 .j .| , E  .| $H 1 .H 81  .V .../.. ..0A......6.o.;..2......| ,P!@e .| $!]  .| 8!  | , "^ A| Ld"( l | 0"  *.| L# 8t ! Eusagemain J%Version4X ,set_program_name|program_nameP |version_etc_va version_etcfemit_bug_reporting_address(version_etc_copyright<A4Elast_componentbase_lenbase_name`u1Jclose_stdout_set_file_namezclose_stdout_set_ignore_EPIPEclose_stdoutry(errorverror_at_lineerror_print_progname)error_message_count;error_one_per_lineexit_failurefchmodat-+strmodefilemodestringS fts_close fts_set fts_openfts_children`fts_read3 _getopt_internal_r&_getopt_internalrpl_getopt,rpl_optarg>rpl_optindPrpl_opterrbrpl_optoptf_:Drpl_getopt_long_getopt_long_rwrpl_getopt_long_only_getopt_long_only_r=hard_locale> Mhash_get_n_bucketshash_get_n_buckets_usedhash_get_n_entrieshash_get_max_bucket_length:hash_table_okhash_print_statistics hash_lookupZhash_get_firsthash_get_nexthash_get_entries_hash_do_for_eachhash_string2hash_reset_tuninghash_initializehash_clear4 hash_free hash_rehashu hash_insert hash_deleteNKi_ring_init7i_ring_emptyji_ring_pushi_ring_popH M:mode_compile~mode_create_from_refmode_adjustRopen_safer#Stopenat_proc_name$9W:quote_nquoteW1 clone_quoting_optionsget_quoting_styleset_quoting_style,set_char_quotingset_quoting_flags`quotearg_bufferquotearg_alloc_memquotearg_alloc quotearg_free9quotearg_npquotearg_n_memquoteargquotearg_mem quotearg_n_styleo quotearg_n_style_mem quotearg_style quotearg_style_memQ quotearg_char_mem quotearg_char quotearg_colon quotearg_colon_mem_ quoting_style_args quoting_style_vals#dget_root_dev_ino8g4save_cwdrestore_cwdfree_cwd:hErpl_vfprintfjxgetcwdememrchrrpl_strndupvasnprintfݧDrpl_wcrtomb!Vprintf_frexp hprintf_frexplWrpl_isnanl# printf_fetchargsprintf_parse__umoddi39 X Gj  HAIuJxK MtOQ63Tpu _:}=d~> K$ MRЎ.SI9WL-W| dxJgĝ:hTj&A  drilGf.1< H "  =   = 8z = H Al`t-eMe?S|iu|lu|P    % * 5 J~U"22u*~zH[Obr$#6#6/Sbq<O:u; k  4 q  l k {+uk ; 4   q l k 8{+0Huk ; Z   q ^ l . R #k qv+027LLN|!ci  2 9   T}$&rw,rT,r(hPcQTV\ItI64 o ~Y ~`c@ ` e T [ _|,v)9D_]HKZ]LWz;BD }"xK^|*^8UHd~m91w~,6$ S ,091u00/0v//#.-.)+H+z'C)d$w$!!jy hlC\0 ' lX0000tz 0C '  0C ' 1 000D0//c/v/@/S/w..-.;.-#.----R+++)+***)*)*)%&w$% &!=aR+_+w$$ 000D0//c/v/@/S/w..-.;.-#.----_+++)+***)*)*)%& &!=j-.;.'b-.;.w..-#.+)+tw..-#.+)+  0D0//@/S/F 0D0//@/S/b h n w   D0u0S/c/.@/..;.w.--,-,,++++**@*}*C))& '!"y'2l  ..--++ S !!C\ d 091u00/0v//#.-.)+H+z'C)d$w$jy h0 ....,,+,H+R+*+}**)*@*&&%)%"d$&!! '=2\p#t~YB*+)*@* '='2\p0\!!H+R+%)%zH+R+%)%zH+R+%)%0*+)*@* \ps)*@* \p\g-L**U--++**& '!&"y'o++@*}*j..--++j..--++<@AJz~!2P "# "#g!2X"0p)*@*)*@*D+#.-.d$w$Z#.-.d$w$'....,,+,}**&&"d$&!!'--++**& '! "yK--*)*)*l--*)*)*" !00//c/v/!&!* 8 > G S 00//c/v/o u { &!!....,,}**&&"d$H"L"M"V""""""d$..,,&&"n#.."#..#G###&&#d$##$$$$$$$$)%&--_++L%s&--_++&&%K&--_++&&%%%%'8)091u00/0v//'8)091u00/0v//'(091((091(8)u00/0v//C))D0u0S/c/.@/..;.w.,-,,,,D0u0S/c/.@/..;.X.,-////(;TY@O(xT #0~T #0< m0#< mX#1u 5< AuFy0/"0*.w GNU C 3.4.3 (csl-sol210-3_4-20050802)chmod.c/opt/pkgs/coreutils-7.4/srca_char__FILE_cntpad_ptr_base_flag_magic__orientation__ionolock__seekable__extendedfd__xf_nocheck__fillerunsigned charlong long unsigned int__longlong_tlong long intblksize_toff_tptrdiff_tshort intshort unsigned intu_longlong_tulong_tino_tblkcnt_tlong doublemode_tuid_tgid_tdev_tnlink_ttime_ttimespectv_sectv_nsectimestruc_toptioncommand_namehas_argnostatst_devst_pad1st_inost_modest_nlinkst_uidst_gidst_rdevst_pad2st_sizest_atimst_mtimst_ctimst_blksizest_blocksst_fstypest_pad4get_root_dev_inoI_ringir_datair_default_valir_frontir_backir_empty_Boolmbstatehash_tablecycle_check_statefts_curfts_childfts_arrayfts_devfts_pathfts_rfdfts_cwd_fdfts_pathlenfts_nitemsfts_comparfts_optionsfts_leaf_optimization_works_htfts_cyclefts_fd_ring_ftsentfts_parentfts_linkfts_numberfts_pointerfts_accpathfts_errnofts_symfdfts_ftsfts_levelfts_namelenfts_n_dirs_remainingfts_infofts_flagsfts_instrfts_statpfts_nameFTSENTChange_statusCH_NOT_APPLIEDCH_SUCCEEDEDCH_FAILEDCH_NO_CHANGE_REQUESTEDVerbosityV_highV_changes_onlyV_offusagech_statusemit_bug_reporting_addressmainargcargvnewmodenew_mode_lenmode_allocpreserve_rootreference_filearg_lenmode_comma_lendev_ino_bufprocess_filesbit_flagsprocess_filefile_full_nameref_filefile_statsold_modenew_modechmod_succeededmode_changednaively_expected_modenew_permsnaively_expected_permsnew_statsdescribe_changefchmodat__iobrpl_optargrpl_optindoerrnoVersionexit_failureset_program_namemode_changeexchangeumask_valuerecurseforce_silentdiagnose_surprisesverbositylong_optionsversion.cprogname.c/opt/pkgs/coreutils-7.4/libargv0find_non_slashversion-etc.c__gnuc_va_listversion_etc_vadirstreampackageconversionn_authorstmp_authorsversion_etcversion_etc_copyrightversion-etc-fsf.cbasename.clast_componentsaw_slashbase_lenprefix_lenbase_nametmp_lengthcloseout.cclose_stdout_set_file_nameclose_stdout_set_ignore_EPIPEignoreclose_stdoutwrite_errorold_file_nameerror.cerror_tailerrnumprint_errno_messageprintf_fetchargserrbuferror_at_lineold_line_numbererror_print_prognameerror_message_counterror_one_per_lineexitfail.cfchmodat.csaved_cwddesclchmod_rplsaved_errnoproc_fileproc_resultproc_errnofilemode.cstrmodeftypeletpmode_bitsfilemodestringxfts.cchdir_countergl_uintmax_tdirentuse_d_inod_offd_reclendd_fddd_locdd_sizedd_bufa_floatHash_tableActive_dirfts_entLCO_entopt_okAD_compareAD_hashtable_sizeleave_dirpfoundfd_ring_clearfts_set_stat_requiredcwd_advance_fdchdir_down_oneprev_fd_in_slotfts_lfreebucket_headfts_allocfts_closefreepfree_dirLCO_hashLCO_comparefts_setfts_compare_inofts_statfollowfts_pallocmorenew_lenfts_sortdummyxfts_opendefer_statmem1mem2mem3fts_maxarglensetup_dirdiropenopen_flagsfts_safe_changediris_dotdotnewfdbailparent_fdfts_builddtypedirpoldaddrdescenddoadjustnlinksmaxlendir_fdis_dirskip_statopendiratnew_fdset_stat_typefts_padjustfts_childrenfts_readcheck_for_dirhash_get_nextenter_dirad_from_tablelink_count_optimize_okfts_loadgetopt.cREQUIRE_ORDERPERMUTERETURN_IN_ORDER_getopt_datarpl_opterrrpl_optopt__initialized__nextchar__ordering__posixly_correct__first_nonopt__last_nonoptbottommiddle_getopt_internal_roptstringlongoptslongindrpl_getopt_long_onlyprint_errorsnameendexactambigindfoundoption_indextemp_getopt_initialize_getopt_internalrpl_getoptgetopt1.crpl_getopt_longopt_index_getopt_long_r_getopt_long_only_rhard-locale.chard_localecategoryhardhash.cHash_hasherHash_comparatorHash_data_freerHash_processorhash_entryhash_tuningshrink_thresholdshrink_factorgrowth_thresholdgrowth_factoris_n_bucketsHash_tuningnew_bucketbucket_limithash_get_n_buckets_usedhash_get_n_entriesfree_entry_listhash_get_n_bucketsnew_tablehash_get_max_bucket_lengthcursorhash_table_okhash_print_statisticshash_lookupnew_entryhash_get_firsthash_get_entriesquotearg_bufferbuffer_sizehash_do_for_eachprocessor_datahash_stringa_stringhash_reset_tuningcheck_tuningepsilonhash_initializenew_candidateprev_failnext_primeis_primedivisorsquarehash_clearhash_freeallocate_entryfree_entryhash_find_entryhash_deletehash_rehashhash_insertdefault_tuningi-ring.ci_ring_initi_ring_emptyi_ring_pushdest_idxold_vali_ring_poptop_valmodechange.cuint_tno_more_affectedmentionedmake_node_op_equalsmode_compilemode_stringinvalidno_more_valuesoctal_modeneededxnmallocmode_create_from_refref_statsmode_adjustoldmodechangesomit_changepreservedopen-safer.copen_saferopenat-proc.copenat_proc_nameproc_statusbufsizeproc_self_fdproc_self_fd_dotdot_stproc_self_stdotdot_bufquote.cquote_ngettext_quotequotearg.cwchar_tc_quoting_styleliteral_quoting_styleshell_quoting_styleshell_always_quoting_stylec_maybe_quoting_styleescape_quoting_styleclocale_quoting_style__mbstate_tclone_quoting_optionsquote_these_tooslotvecqsizeget_quoting_styleset_quoting_styleset_char_quotingshiftset_quoting_flagsquoting_options_from_stylemsgidtranslationquotearg_buffer_restyledbuffersizeargsizequote_stringquote_string_lenbackslash_escapesunibyte_localeelide_outer_quotesforce_outer_quoting_stylec_escapec_and_shell_escapestore_cstore_escapeprintableilimbytesleftquotearg_alloc_memxcharallocquotearg_allocquotearg_freequotearg_n_optionspreallocatedquotearg_nquotearg_n_memquoteargquotearg_memquotearg_n_stylequotearg_n_style_memquotearg_stylequotearg_style_memquotearg_char_memquotearg_charquotearg_colonquotearg_colon_memquoting_style_argsquoting_style_vals__ctypedefault_quoting_optionsslot0nslotsslotvec0root-dev-ino.croot_d_istatbufsave-cwd.csave_cwdrestore_cwdfree_cwdvfprintf.crpl_vfprintfformatoutputlenbufxgetcwd.cxgetcwdxmalloc.cxmallocxreallocx2reallocx2nreallocxzallocxcallocxmemdupxstrdupinvalid_argfseterr.cfseterropenat-die.copenat_save_failopenat_restore_failxalloc-die.cxalloc_diexstrndup.cxstrndupchdir-long.ccd_bufcdb_advance_fdcdb_free__func__fclose_failchdir_longFaildir_endn_leading_slashcdb_initcdb_fchdirclose-stream.cclose_streamsome_pendingcycle-check.ccycle_check_initcycle_checkis_zero_or_power_of_twodup-safer.cdup_saferfd-safer.cfd_saferrpl_getcwdfd_needs_closingrootdevthisdevrootinothisinoa_allocatedmemory_exhausteddotdevdotinomount_pointparent_statusdirroomnamlenmatchentry_statusoldsizesavembrtowc.crpl_mbrtowcinternal_stateretcountmemrchr.cmemrchrc_inlongwordchar_ptrlongword_ptrrepeated_onerepeated_clongword1rpl_strndupvasnprintf.cwint_tTYPE_NONETYPE_SCHARTYPE_UCHARTYPE_SHORTTYPE_USHORTTYPE_INTTYPE_UINTTYPE_LONGINTTYPE_ULONGINTTYPE_LONGLONGINTTYPE_ULONGLONGINTTYPE_DOUBLETYPE_LONGDOUBLETYPE_CHARTYPE_WIDE_CHARTYPE_STRINGTYPE_WIDE_STRINGTYPE_POINTERTYPE_COUNT_SCHAR_POINTERTYPE_COUNT_SHORT_POINTERTYPE_COUNT_INT_POINTERTYPE_COUNT_LONGINT_POINTERTYPE_COUNT_LONGLONGINT_POINTERarg_typea_schara_uchara_shorta_ushorta_inta_uinta_longinta_ulonginta_longlonginta_ulonglonginta_doublea_longdoublea_wide_chara_wide_stringa_pointera_count_schar_pointera_count_short_pointera_count_int_pointera_count_longint_pointera_count_longlongint_pointerargumentargumentsdir_startwidth_startwidth_endwidth_arg_indexprecision_startprecision_endprecision_arg_indexchar_directivemax_width_lengthmax_precision_lengthchar_directivesfpucw_tdecimal_point_charpointbufvasnprintfresultbuflengthpout_of_memory_1out_of_memoryoverflowbuf_neededlengthbuf_mallocedaugmented_lengthmemory_sizehas_widthpad_ourselvesprefix_countprefixesbuf_memsizehas_precisiondigitparg_endcharacterstmpbuf__x_ntmp_memsizesign_wordexponentmantissadigitbigger_needndigitsoldcw_ncwxsum4size1size2size3size4xsumis_infinite_or_zerolis_infinite_or_zeroxmaxxsum3wcrtomb.crpl_wcrtombprintf-frexp.cprintf_frexpexpptrprintf-frexpl.cprintf_frexplpow2powhpow2_ipowh_iisnanl.cmemory_doublerpl_isnanlprintf-args.cwide_null_stringprintf-parse.cprintf_parsearg_posnd_allocated/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3/gcc/libgcc2.c/builds2/sfwnv-111a/usr/src/cmd/gcc/gcc-3.4.3-i386-build/gccUSItypeUDItypeDWstructDWunion__umoddi3__udivmoddi4__cbtmp.interp.SUNW_cap.hash.SUNW_ldynsym.dynsym.dynstr.SUNW_version.SUNW_versym.SUNW_dynsymsort.SUNW_reloc.rel.plt.text.init.fini.rodata.rodata.str1.1.rodata.str1.4.rodata.cst4.rodata.cst8.got.dynamic.data.bssf.picdata.ctors.dtors.eh_frame.jcr.data.rel.local.bss.symtab.strtab.comment.debug_abbrev.debug_info.debug_line.debug_frame.debug_pubnames.debug_aranges.debug_ranges.debug_str.shstrtab oo00Z'   /"s7oT,T,Eo,,Ro..c p1p1@o B11  s33Px 8 8~  h 22b ,  (((PPX( ( ( ( ( ( 0 0 8 8 l         P!' " /3 8<1FnR*):^dt#k {&0޵! 0707011d719d6d000081ed0000000000000000000000014a5bb2cb0002ca140000012e00000002ffffffffffffffff0000001900000000root/opt/aosug/bin/chownELFX7444 (,+44oXXXX X/usr/lib/ld.so.1 !#$%&'()+,-/035789:;=>ABCEFHIKLMNPQSTWY[^`bcdghjlmrtuvxz|}  "*.1246<?@DGJORUVXZ\]_aefiknopqswy{~!,t8 B8 NVcmxP RL 8S  XS ,TI xT1 TY #U& -0U| 7V @V LW@ \\WO eXx p$Y yx] h`n $r  /  ȇ '2 BH, Pt" i0Q |К+ H- x. .<HS]j|1 }!  86d E $Mj 56=8O6Vܘ c J r4E ~O` (4X7 X6 H (734  ( 5@ d  &5-656%؞ @J Q5Y jH7"@̙ \ @  # h6x! O'  #$. 8(4@ J85P87VD h5q& L4 36TQ  ! h40 P84`  ,   9t= CpId  Q(J Z0L hd op8 w` $1 5  - ,R  ]  m "e .X36g CX4L3Xx3_ĉM l4sX0;Y k % T (58P 27b 5 Qk p+ H) 5Wh3,  U#  tM^ ' l : | P 4[ @ f @: r D / 4A   $ 5  4 @^ 6 h5 6! N   P ؀ 1 4 = 5E . P & d  l 3  G  V' )   ' Rx 6 7~ H 4 3 . X3 P   5 6( Ę 1 POF @ NZ [ 4c <p X z (6 xD 5 i  |R 8 x6  7   4 %  z  # ! ,L - 2 G DT 4[ 49 a  k H4q @, v P| ؃ $ 8  3 \ x4  t AY \ 93 X5 3  x5 |m % H6 H5. x 3@ s  S @: _ 26i ,P  fchownfsr.scrti.svalues-Xa.ccrtstuff.c__do_global_dtors_auxframe_dummychown.cchown-core.cversion.cprogname.cversion-etc.cversion-etc-fsf.cbasename.ccloseout.cerror.cerror_tailexitfail.cxfts.cAD_compareAD_hashleave_dirfd_ring_clearfts_set_stat_requiredcwd_advance_fdfts_lfreefts_allocLCO_hashLCO_comparefts_compare_inofts_statfts_pallocfts_sortfts_safe_changedirfts_buildgetopt.cexchangegetopt1.chard-locale.chash.ccheck_tuningallocate_entryfree_entryhash_find_entryi-ring.copen-safer.cquote.cquotearg.cquoting_options_from_stylegettext_quotequotearg_buffer_restyledquotearg_n_optionsroot-dev-ino.cstpcpy.cumaxtostr.cuserspec.cparse_with_separatorvfprintf.cxmalloc.cxstrtoul.cbkm_scalebkm_scale_by_powerfseterr.cxalloc-die.cxstrndup.cclose-stream.ccycle-check.cdup-safer.cfd-safer.cmbrtowc.cvasnprintf.cdecimal_point_charwcrtomb.cprintf-frexp.cprintf-frexpl.cisnanl.cprintf-args.cprintf-parse.clibgcc2.c__do_global_ctors_auxcrtn.sendgrentget_quoting_styleclone_quoting_optionsset_program_namestrnlen__longdouble_usedfclosequotearg_memquotearg_allocrpl_strndup__environ_lockbase_name_startfwritedup_safercycle_checkprintf_frexpstrcpyopenat64quotearg_colonprintf_fetchargsgetenvhash_rehashhash_lookupquotearg_freexcallocsprintf__fpendingget_root_dev_inostrncmp__fsr_init_value_get_exit_frame_monitorVersionquotearg_char__umoddi3hash_get_max_bucket_lengthquoting_style_valsrpl_getopt_long_onlymemcpy_endrpl_getoptbase_len__1cG__CrunMdo_exit_code6F_v_quotearg_n_style_memfstat64xfts_openqsortldexpquotearg_char_memiswprint_getopt_long_rrpl_opterr_lib_versionfchdir_environquotearg_alloc_memgetgrgidrpl_mbrtowchash_do_for_each_DYNAMIC__ctype_Jv_RegisterClassesfstatat64hash_get_firstprintf_parsei_ring_emptyx2realloc_finifseterrfd_saferhash_table_okstpcpy_mcounterror_one_per_linehash_get_nextquoting_style_argsvasnprintfopen64__deregister_frame_info_baseserrnohash_deletequotearg_n_styleerror_at_linexstrndupclose_streamrpl_wcrtombgettextfts_childrenfchownatfputsrpl_vfprintfhash_insertxmalloc_GLOBAL_OFFSET_TABLE_bindtextdomainquotearg_stylexreallocclose_stdoutatexitwcslen_getopt_internalxstrtoulerrorxalloc_diestrchrcycle_check_initfts_closeversion_etc_vaquotearg_style_memhash_print_statisticsstrerror_rchopt_freegid_to_namehash_get_entriesversion_etc_copyrightchown_filesquotearg_colon_memxzallocxstrduperror_message_countfflushrpl_isnanl__assert_c99dirfdfcntlversion_etcrpl_optindhash_get_n_bucketshard_localelstat64open_safer_getopt_long_only_rquote_nerror_print_prognamequotearg_n_memquotearg_bufferquotearg_nfts_seti_ring_initgetpwnam__fsrrpl_optopt__flsbufgetpwuidhash_string_etextclose_stdout_set_file_namememsetmbsinitquotearglast_componentemit_bug_reporting_addressmemmove__dso_handle__udivdi3endpwenti_ring_popreaddir64fts_readrpl_optargumaxtostr__iobprintf_frexplwctomb___Argvhash_get_n_buckets_usedstrrchrxmemdupparse_user_specrpl_getopt_longi_ring_push_PROCEDURE_LINKAGE_TABLE_exit_failurestrcmpusagehash_freeabortchopt_init__register_frame_info_baseshash_reset_tuningset_quoting_flags_exitset_char_quotinghash_clear_edatafdopendirsetlocalehash_get_n_entriesclosedirhash_initializegetgrnamset_quoting_style_getopt_internal_ruid_to_name__fpstartclose_stdout_set_ignore_EPIPElibc.so.1SUNW_1.23SUNW_1.22SUNW_1.21SUNW_1.18SUNW_1.1SUNW_0.7SUNWprivate_1.1SYSVABI_1.3/usr/ccs/lib:/lib:/usr/lib:/usr/sfw/lib y y y y '=  (=  qN  7                                     e0Zc3 !#"#%/ (~q)*!*+,p`YX-123_r4^|lw9v=>hg"aJ m}b \{n/#tT|B8 UdjhlpxTB]ra`=1E_Cxc:h3  "$q(,0S468<@DHLP+TX\`dh>lptxk|4$5\%`%dh%hh%lh%ph%xh %h(%h0%h8p%h@`%hHP%hP@%hX0%h` %hh%hp%hx%h%h%h%h%h%h%h%hp%h`%hP%h@%h0%h %h%h%h%h%h%h%h%h %h(%h0% h8p%h@`%hHP%hP@%hX0% h` %$hh%(hp%,hx%0h%4h%8h%<h%@h%Dh%Hh%Lhp%Ph`%ThP%Xh@%\h0%`h %dh%hh%lh%ph%th%xh%|h%h %h(%h0jj츌t R{hpn tt PMEu TRU RP/"}X PP&.URQ  t`|$у D$td$у`tƒ 3fd$f T$tfd$f L$l$YZ]ÐUS[Rt :ҋu鋃t (Phƃ]ÐUS[P$tSj P(P7t,t P!]USP]t,P5 PhZYPhX   SQ5 5 h$XZhH hl$YXhH h$XZhH h$YXhH hq$XZhH hX$YXhH h?$gXZhH h&$NYXhH h $5XZhH h$5 5 5 h$hQ5 YZPh$ hhh$XZhH ho$$7EZ 5 :ZYPh5$M/UWVS} 7uƅDž Dž$Dž(Dž,DžDžvY[hjXZhh$$8PEȉ$ jhh WVC t`fL<=~H> jhh WVDžNC u}Bɉ P E)ȅ8PRsX \R $Z\EE=#v$chSDž=|V=, R ]3P~,ofF>I9MEEuFU9BEE؅uEErSE$M ɈMg}GBE@U$B 1}ы}E$L9HEtM܋U }WUB vEM$A ;Ete[^_É;Ets9]t E D;]}BU 8-CM$;E}"} :-uzuÍCM$;E|މËE$]X$M$A 9]tE$X 둃PuXEM$@A}Vu.uU$:8WP:t+e[^_Ëu}$FG}؉u}&x:BM$A8A }$G뫋}u1}ыU}$CLOG?e[^_ËEt/M$AvV} 7WhֺZYPhX ٺU$?r뵋Et)M x-t}PuEtBU x-+ U$rPM 1ShUZYPhX X }$E$U$@C?BP;nM$EEEEA8A E$p p҈Ut= FɈMt=u]EL}$)}EPuu3ٻu(;I9M%EȅEEuEt }ąsEȅ}UȋzFM$A M$Q1ыE$LHEtMU }ȋWG 1F9BiF 9B ]_};UCM$} A xBVE 0Sh4}؉u}E }$;UB}$M G }$G8t:G U$Bj}$;UBM$} A E$@ 뿋U]ȉUnu}EUэLU}$B OGM9:D:}wU$rM<:t:M$WAM$q2Ph4^_PhX 7UȃzM$;U*B} UȋB $}U$rM9:\:EtFM Dx- U2PM 1Qh菶_ZPhX 蒶}$ }1}ыELU$JMA B?C}]ȉ}EE t0ShZYPhX !U$RUCVE 0Sh,ZYPhX cut$E t0Sh迵ZYPhX µM$Q׊EэLE$HU::M 41ShNrZYPhX u}$GE!VE 0Sh,AZYPhX DN]M$Q1ыE$LH?}71WhT[^PhX E$@ESuuTE$P1ыE$LH?}7E 0Qh胴_ZPhX 膴MM$} 47ShVZYPhX YUh u uuuuu Pu L  P  H ÉU jjjjuu u U jjuuuu uZ ÐUujjuuuu u3 ÉU jjuuuu u ÐUujjuuuu u UWVSjuVPtw PktehV$tSPCt(hVtSPu1SVز$@e[^_ËD$@ËD$@ ËD$@VSD$ X19v*vtAB@u9v։9w[^WVS|$_119vtFABvA@u9w9w t1[^_9Ot1UWVS u[[u@Yu=ZuBWhu E話 Vhu 蘱1҉$S,$1҃RV,$ $$Shu juhu We[^_UWVSu} vWVƒ9Fv<1҅t3WVu[u1ҍe[^_Ëe[^_ȱUMQ1tIv9vt蘱UVS]su VS‹K9v7Ѕt90t"@vu 9r1e[^É@tڋ8UWVSD$p19ދl$|$v"t9sRDAu9w[^_]UWVS E0@19v0t"u3U t[GuUB9wэe[^_ÍvVSL$ t$1)1Au[^ÉWV|$ P^_ÉP(BEu,Et1APÉB 0Euu+BEuuEuÍvUWVS,}] M j(0ƃ1*^'{u?1ҋERP,$s4كtn}fE fEm}mEE}wKM vY 9Es1҉uԅtEԋEԍ@9ˉEr1҉uԅu.؃ V蕮e[^1_ù 렻P.Nw΃jQ1‰tF‰FEFEF F F~F$e[^_ÍvUWVS }7G9vzvtj^O SG$҉C_$t,t 3ыSG$҉C_$O u׍vu-FG9wG Ge[^_à 6уNjO 뾉UWVS EP ҉Ex8@9vh7t#t 3MQ [uUB9wЋM9v-v_t sSuUB9w֋MY$ sS踬u E0袬UUe[^_鍬E@낍vU@$t ‹@A$ɉÐ j*ƒÐH$JP$UWVSƊE EvRVƒ9^E1t&RWVt4};t KuIe[^_É0WVu[Cue[^1_ËS}:tŋBC QSʉ>ūUWVSEp pppu ǃ 1UB$G$EB;EvUtqv;]FC^]tKwPEW4ƒ9wSɉUuUG ;]tډ}]uUBE;Ey E0褪UGBGBG B G$B$<$}e[^_ÉtEFBV7航1UVS] ۋu%jEPډt e[^ÉEu;]s MuEEC8uE}1IMEH }E;u EUUM< EEE;E wu<2uiUEJRMUzM'gEt%}uu;]sUEMCu;]su貞USPMɋU t1 APq1uuE ]Ív ȐUWVS}MWɉEUtk GPu7u 1҉Eu1MÃCSEZuu7u uډ&EU tUEe[^_ÐU덿 nUuju uBÐUVS;\5`s t@C;\rF= t P!TX Tt V`T\e[^ÍvUWVSƅUE`#95\wyVTEUE}PP}ã`tTXS=\M)1<E\E UP|PRE؋E 0uUuUi 9EwI@ Et Wݛ u_Duu܋U 2uuU Ee[^_É1̛ vUh EU jÍvUh uEU sÉUujÍvU u ujUS4]ȋU SjUE]ÍvUS4]ȋU SuUE]ÉU u ujUuu ujÐUWVS<}  EjP]S$Uu 1oe[^_U E PjuÉUj:uÍvU j:u uuUShPh2]1҅ux|hSCډЋ]L$T$ABuAUWVS E]u x@vjj VSJ0Ojj VSIÉЃ ؉uԍe[^_UWVSLӉU EEUEU1EEt}){st~t(?+t} WtmPU֚M u蘘 W茘Xuӗe[^_À9t Qǃ1{t hEPj jW uEąxEidU[FPQǃ06 @ PE貗[PE>+tY VtI@EЙ VEUUEUE E8UE1 hEPj jV uE똡lExhU냃EP1REP6UWVSuj:V記uuuu ‰ۉt e[^_Ívtj.Vituuuu ‰eu1UWVSuu PP}DžƋtRWSjP蕘9rۉx1e[^_Í9t VO WPUS]S訖t]Åt+vUS ] Su͖t]ÐtvUSR]M ۋtsB‰U ]X[u@vUS]S\ SjP8]Uu utyUS] S SuPS]ÍvUW U1QR}Sщ1Ҹ9s[Ívщ1[ÍvUWVSQ1]E E KuZ[^_ÉUWVS]$uE} B u-PSWVp9Et"EuEPuVttj0u=tCDtIBt>B5wA$hjShhʕ} }E봋EUEe[^_úECU E8tMEUEe[^_ËEPuetvEi'{BEjE[njjj1]Ijjjjú/e[^_UVS]PuE PSt e[^Ð1҅tK8uut7 hPh Pjjme[^ D$H UhؐPhjDP*譑Uu utUVSuV˓E^ 4$ɓut+}u = tu e[^Ée[1^D$@ @@ÉUWVS Exthj0KI;w0CJu+;<+889؍49Ήs;<<  9Љt ـE@tt DJu0DB$C٭X۝T٭ZCTP0$$C uEt ۽'ۭCEٽZfZ @fX0Ev٭X۝T٭ZTP$$ڃC ~DA$ 뮃 -3F<vF<w Dž:\O AOu\8ml<$۽a ۭ؋DA$A<NCACN{ٽZfZ fX}9@t@t @dLt Ld ud|1XDE |nKI;w0CJu + f 1ۃ؃w ICNCFC? E 21 EEEsEEc E %E EF9sE_;UlURU> PMR PoQ u\QEEG E.EE E PQEEEEvEEE|EpB< E }̙w U̍D9sEFA< v̋]̅tM}SEH^G MAu8U Bt PO AURU POUWV T$(t$|$ D$$҉t$ʼn$u9vGD$ 1^_]Ív9<$v1v$ǃuA;4$w19l$r̹Őu 11ʼn1NjD$ ^_]ø )D$$L$ ‰$L$D$L$ Ɖ4$d$9wB;D$8I2UWV(D$@T$DL$ ƅҋD$. write errorUnknown system error%s: %s:%d: %s:..--POSIXLY_CORRECT%s: illegal option -- %c %s: invalid option -- %c %s: option `%s' is ambiguous state->magic == CC_MAGICPOSIX# entries: %lu # buckets: %lu max bucket length: %lu "'`xstrtol.cinvalid argument: %smemory exhaustedcycle-check.c%#.0f%+d(NULL)recursivechangesno-dereferencefromno-preserve-rootquietsilentverbosehelpversionliteralshellshell-alwaysc-maybeescapeclocale7.4invalid userinvalid groupinvalid specTry `%s --help' for more information. Usage: %s [OPTION]... [OWNER][:[GROUP]] FILE... or: %s [OPTION]... --reference=RFILE FILE... Change the owner and/or group of each FILE to OWNER and/or GROUP. With --reference, change the owner and group of each FILE to those of RFILE. -c, --changes like verbose but report only when a change is made --dereference affect the referent of each symbolic link (this is the default), rather than the symbolic link itself -h, --no-dereference affect each symbolic link instead of any referenced file (useful only on systems that can change the ownership of a symlink) --from=CURRENT_OWNER:CURRENT_GROUP change the owner and/or group of each file only if its current owner and/or group match those specified here. Either may be omitted, in which case a match is not required for the omitted attribute. --no-preserve-root do not treat `/' specially (the default) --preserve-root fail to operate recursively on `/' -f, --silent, --quiet suppress most error messages --reference=RFILE use RFILE's owner and group rather than specifying OWNER:GROUP values -R, --recursive operate on files and directories recursively -v, --verbose output a diagnostic for every file processed The following options modify how a hierarchy is traversed when the -R option is also specified. If more than one is specified, only the final one takes effect. -H if a command line argument is a symbolic link to a directory, traverse it -L traverse every symbolic link to a directory encountered -P do not traverse any symbolic links (default) --help display this help and exit --version output version information and exit Owner is unchanged if missing. Group is unchanged if missing, but changed to login group if implied by a `:' following a symbolic OWNER. OWNER and GROUP may be numeric as well as symbolic. Examples: %s root /u Change the owner of /u to "root". %s root:staff /u Likewise, but also change its group to "staff". %s -hR root /u Change the owner of /u and subfiles to "root". %s home page: General help using GNU software: Report %s translation bugs to failed to get attributes of %s-R --dereference requires either -H or -Lchanged ownership of %s to %s it is dangerous to operate recursively on %s (same as %s)use --no-preserve-root to override this failsafeownership of %s retained as %s failed to change ownership of %s to %s neither symbolic link %s nor referent has been changed failed to change group of %s to %s it is dangerous to operate recursively on %sfailed to change ownership of %s License GPLv3+: GNU GPL version 3 or later . This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by %s, %s, %s, %s, %s, %s, %s, %s, %s, and others. Written by %s, %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, %s, and %s. Written by %s, %s, %s, %s, and %s. Written by %s, %s, %s, and %s. %s home page: . General help using GNU software: . %s: unrecognized option `%c%s' %s: unrecognized option `--%s' %s: option `%c%s' doesn't allow an argument %s: option `%s' requires an argument %s: option requires an argument -- %c %s: option `--%s' doesn't allow an argument %s: option `-W %s' doesn't allow an argument %s: option `-W %s' is ambiguous # buckets used: %lu (%.2f%%) 0 <= strtol_base && strtol_base <= 36B=fff?̌?OO?A=@??2233.3>3N3^3n3~33333333344.4>4N4^4n4~44444444455.5>5N5^5n5~55555555566.6>6N6^6n6~66666666677.7>7N7 P p  T t  ``@``-`o?od+o80`0xo`o``XH7? TzR|0 L  zR|0 L 8t |t Td++- `0 0 2 X7 Pp$PXpppxT X `  !"#$%&'()*+;A +>S ^eq|` ppxT X ` t8 d 8 '/<|  J Yfp{  P    +1RL <8S  DXS N,TI \xT1 rTY U& 0U| V V W@ \WO Xx $Y x] h`n $r  (*1P@ M/ \ gȇ wT \` (2 H, t" 0Q +:COZdkh}lК+ H- x.  *  &2=G Xe|1 xX \ t|P T   4I86Rd dE zMj 686ܘ   4E O` 4X7 X6 H (73%4. = ~ N5U@ ad m |566{؞ J 5 H7"@̙ \ @  &# ;h6BGx! RO' [ y$. (4 8587D 5& L4  3 6& TQ 7 A  !H \ h4f 0 84u `    t= p d  (J 0L d p8  ` $ 1 5 1 7  C - T ,R  ] b  k m x e X3 g X4 3 x3 ĉM 4 X 0;Y % T (5 8P  2 7! b 2 5 ; Qk A p+ H) L 5 h3S , d U# n tM^ } l | 4 @ @: D / 4A    $  5 2 49 @^ D 6Q h5W 6!] N  i Pt ؀ 4 5 . &   3  G   V' ) @   ' x